Нажмите "Enter", чтобы перейти к содержанию

Население саки: Город Саки: климат, экология, районы, экономика, криминал и достопримечательности | Не сидится

Содержание

Город Саки: климат, экология, районы, экономика, криминал и достопримечательности | Не сидится

Общие сведения и краткая история Сак

На северо-западе полуострова Крым раскинулся маленький город-курорт Саки. Он находится в 5 километрах от Каламитского залива Черного моря и соседствует с красавицей Евпаторией. Свое название, тогда еще поселок, получил от крымскотатарских племен Сак, живших на берегах озера Чокрак, что в переводе означает «живой родник».

Въезд в Саки со стороны Евпатории

Статус города поселок Сак получил в 1952 году. А вот о излечивающих свойствах сакской грязи известно было еще в седой древности.

В трудах древнегреческих авторов, Плиния и Геродота, несколько раз упоминаются волшебные свойства грязи и воспеваются лечебные качества Сакского соляного озера. Археологи уверяют, в античности на месте Сак уже была здравница.

Официальной датой рождения курорта называют 1827 год. В городе работали известные российские врачи Н.Н Бурденко и С.С Налбанов. На лечение в Саки прибывали российские и европейские аристократы. Н.В Гоголь и Леся Украинка поправляли в Саках свое здоровье.

Климат и экология города Саки

Климат города очень мягкий. Близость моря в сочетании с бескрайними степями, дарят уникальный приморско-степной климат. Летом средняя температура держится в отметке 23, 3 Сᵒ, зимой −1Сᵒ. Летний зной прекрасно освежает морской бриз, а зимой почти не бывает снега, зато часто дует пронизывающий ветер. Дожди редки в Саках, из-за этого в середине лета почти нет зелени. Морское побережье прекрасно подходит для отдыха с детьми. Галька, песок и прозрачная вода. Саки лежат в Каламитском заливе, поэтому морская вода теплая, средняя летняя температура ее +17Сᵒ.

Большой трагедией для экологического состояния города был химический завод, 5-ый по величине в бывшем СССР. Там производили марганец, силикатный кирпич, перекись водорода, очищали платину и еще многое другое. Завод обанкротился и прекратил свое существование в начале 2000-х. Но непоправимый вред экологии был нанесен.

Развалины химзавода в Саках

Еще одно химическое предприятие, «Йодобром», существует и сейчас. Начиная с 1926 года, там производят антипирены, неорганические йодсодержащие продукты и прочее. Вред, что способно принести такое предприятие природе, оценить трудно.

Настоящим памятником экологической катастрофы города является огромное озеро Чокрак, что лежит в пределах городка и как бы разделяет его. В него долгое время сливали нечистоты города, отходы молокозавода и нефтебазы. Сейчас озеро, полное рыбы, стоит в «замороженном» виде. Ловить рыбу или купаться в нем запрещено.

Озеро Чокрак

Население Сак

Крым — это многонациональный регион. И Саки не стали исключением. Более 60% населения русские, 25% составляют украинцы и 6% крымские татары, а еще белорусы, молдаване, поляки, армяне, евреи, караимы, греки. Соседствуют между собой национальности прекрасно. Жители городка улыбчивые и добродушные.

На данный момент население города составляет около 24 тысяч человек, а вот в 2006 году проживало более 26 тысяч. Отток происходит за счет смертности пожилого населения и переезда молодых в крупные города полуострова. Как в любом курортном городе Крыма, с круглогодичной, высокооплачиваемой работой в Саках проблемы, поэтому молодежь и перебирается в более крупные и развитые города. Приток населения происходит за счет сельского населения, что перебирается в Саки, и людей с ограниченными возможностями. Они предпочитают покупать квартиры в Саках, так как город идеально приспособлен для нужд людей на колясках. К тому же, санатории города специализируются на лечении болезней опорно-двигательного аппарата.

Саки все же город, где больше людей среднего возраста. От 25 до 60 лет. Многие возвращаются в Саки ближе к старости. Зеленый, тихий городок создан для неспешной жизни.

Сакчане очень добродушны и в большинстве своем интеллигентны. Среди населения много бывших научных сотрудников, медработников, людей творческих профессий. Матерящихся граждан и нагло распивающих алкоголь можно встретить разве что вечером во дворах. Это молодежь, но она кроме шума ничем не навредит и даже принесет извинения.

В Саках нет высшего учебного заведения, а только профессиональный лицей (бывшее ПТУ) и ветеринарный техникум. Тем не менее, среди населения большинство имеют высшее образование. И в основном, медицинское. Это обусловлено спецификой города, ведь Саки старейший бальнеологический курорт Крыма. Людей с профтехническим образованием более 40% населения. Также много специалистов в туристической и сельскохозяйственной отраслях.

Районы и недвижимость Сак

Миниатюрный, даже по меркам Крыма, город Саки общей площадью 29 км², все же делится на четыре района. Это район железнодорожного вокзала, центральной районной больницы, поселок химического завода и центр. В народе все именуется намного проще и делится еще на несколько частей. Элитарность района и цена на жилье варьируется очень странно. И часто не зависит от близости курортной зоны и моря.

Центральная площадь

Вокзал

Прибывая в Саки, жители дальних регионов сразу попадают на ж/д вокзал. Похвастаться здесь особо нечем. Отстроенное еще в середине прошлого века, здание вокзала бережно хранит неповторимую ауру совдепа. Это касается как внешнего вида, так и сервиса. Не стоит ждать приветливой улыбки или носильщика. Зато вокруг всегда много таксистов с алчным блеском в глазах.

Этот район среди жителей города не пользуется популярностью. Общественный транспорт туда ходит плохо, до центра добираться нужно через пустырь, мало магазинов. Да и близость вокзала с его грохотом поездов и обилием сомнительного контингента не внушают доверия горожанам. Цены на жилье здесь варьируются: от 30 до 45 тысяч долларов за трехкомнатную квартиру, 30- 20 тысяч долларов за двухкомнатную и 20- 14 тысяч соответственно, за однокомнатную. Расценки зависят от наличия ремонта.

Большим плюсом этого района является обширный частный сектор. Буквально за 50-60 тысяч долларов можно купить уютный, обустроенный домик с участком за высоким забором и ничего не боятся. Район считается одним из самых криминогенных в городе.

Вид на район вокзала

Центр

Этот район народ про себя условно делит на курортную зону и непосредственно сам центр.

Курортная зона, это собственно одна улица Курортная, самая длинная в городе. Ее протяженность 3 км. На ней расположены главные санатории города: Сакрополь, санаторий имени Н.Н Бурденко, санаторий Саки, санаторий имени Пирогова или военный клинический.

Территория санатория им. Пирогова в г. Саки

Свое начало она берет от дома культуры химиков и городского стадиона, пересекается с центральными улицами, лежит параллельно с Лечебным соленым озером.

Городской стадион, начало улицы Курортная

Улица очень зеленая, даже в середине лета хранит прохладу и свежесть. Еще она очень тихая, машин по ней ездит не много летом, а уж зимой их почти нет. Поэтому жилье на улице Курортная считается элитным и стоит дороже, чем везде. Стоит заметить, что первые этажи в Саках в особой цене, так как в городе много людей с ограниченными возможностями. Пандусы имеются почти во всех магазинах, аптеках и организациях. Квартира на первом этаже по улице Курортная будет стоить около 80- 90 тысяч долларов. Другие этажи тоже в цене. За трехкомнатную попросят 70-80, двух и однокомнатные будут стоить от 35 до 50 тысяч.

Центром можно назвать несколько улиц, это Ленина, Кузнецова и Революции. Улица Строительная достойна отдельного рассказа, раскинулась она на берегах живописного озера Чокрак. Заселена в основном бывшими работниками химического завода. Цены на жилье здесь очень разбросаны. Трехкомнатная «чешка» может стоить 63 тысячи долларов, а может и 45.

Квартира на центральных улицах Ленина и Кузнецова и близлежащих к ним, будет стоить от 20 тысяч долларов за однокомнатную, от 30 и до 60 за двух и трехкомнатную соответственно.

Центром считается район рынка и улица Революции, что ведет к городскому парку. Самая старая и самая ухоженная улочка города закрыта для автотранспорта. Берет свое начало от площади имени Ленина. Цены на жилье в этой части города тоже высоки. 3-х комнатная от 60-70 тыс., 2-х и 1-комнатные в пределах 25-40 тысяч долларов.

Начало улицы Революции

Поселок

Этот район разделен на «старый» и «новый» поселок. Застроенный еще в начале 40-х годов для работников химического завода, старый поселок имеет плохую репутацию. Далек от центра и транспортной развилки. Там мало магазинов. Считается Сакским Гетто.

«Новый» поселок застроен значительно позже. Дела с транспортом, магазинами и криминалом обстоят намного лучше. Там находится Сакский проф. Лицей. Множество частных домиков и небольшая коттеджная улица создают хорошую репутацию этому району. Жилье в «старом» и «новом» поселках имеют почти идентичную цену. Однокомнатная квартира будет стоить от 14 до 20 тыс. долларов, 2-х и 3-х комнатные — 30 и 50 соответственно.

Новый поселок

Больница

Совсем небольшой район, где много частных домов и двухэтажных «хрущевок». Недавно там отстроили микрорайон из 12 и 17-этажных домов, что очень освежило атмосферу. Как понятно из названия района, там расположена районная больница с ее инфраструктурой. Поэтому движение транспорта и магазины, торговые площадки налажены отлично. Стоимость недвижимости в этом районе колеблется от возраста квартиры и ее состояния. В среднем, от 45 тысяч долларов за 3-х комнатную квартиру.

Вид на район больницы со стороны озера

Поселок Новофедоровка

Или просто Гарнизон, находится в 5 км от города и лежит возле моря. Там с советских времен расположен авиационный гарнизон «Саки-4», и знаменит он тем, что в 1945 году принял самолеты Сталина, Черчиля и Рузвельта, прибывших на Ялтинскую конференцию.

В последние годы гарнизон активно застраивается, и жилье там стоит как и в Саках, от 30 000 за однокомнатную квартиру, 3-х комнатная обойдется от 57 тысяч долларов. Цены зависят от близости моря. Активно застраивается Новофедоровка частными гостиницами и коттеджами.

Новофедоровка. Фото by qz1000000 (http://fotki.yandex.ru/users/qz1000000/)

Инфраструктура города

Извечная и слегка опостылевшая проблема о дураках и дорогах актуальна и для Сак. Дороги есть и ведут они в основном к морю, поэтому хотелось бы видеть их в идеальном состоянии. Конечно, основное шоссе, ведущее к морю и в Евпаторию, поддерживается в хорошем состоянии. А вот о покрытии в самом городе нужно сказать отдельно.

Старейший курорт Крыма может похвастать несколькими улицами вообще без асфальта. А ямы и выбоины встретят вас в любом районе городка. Городские власти все видят и понимают, но сделать ничего не могут. Вот вам и дураки с дорогами.

Центральная площадь может похвастать плиточным покрытием. Фото by qz1000000 (http://fotki.yandex.ru/users/qz1000000/)

Но по этим дорогам ездит бесстрашный городской транспорт. В Саках есть железнодорожный вокзал и автостанция. Курсируют маршрутки в двух основных направлениях: по городу и на море. Из автобусной станции можно добраться в любой город полуострова, цена билета не превышает 10 долларов. Несколько лет назад городишка обзавелся собственной службой такси, в услугах которого найдется несколько авто для перевозки людей на инвалидных креслах.

Санатории города работают круглогодично, отдыхает за весь период в городе более 60 тысяч человек. Казалось бы, цвети и пахни город Саки. Но коррупцию никто не отменял, поэтому новое жилье в пределах города не строится. Только территория возле моря достойна чести быть застроенной и ухоженной.

Поселок Новофедоровка может похвастать целым жилым комплексом из гостиниц, кемпингов и коттеджей. Отдых, а тем более покупку такого жилья, сакчанин позволить себе не может. Новое жилье появляется очень медленно, и то в основном для крымскотатарского населения города. Это строительство финансируется за счет крымского Менджилиса и при участии арабских государств.

Площадь Героев в Новофедоровке. Фото by qz1000000 (http://fotki.yandex.ru/users/qz1000000/)

Городские службы, впрочем, как все жители Сак, никуда не торопятся и не напрягаются, в принципе. Эта атмосфера «испанской сиесты» всегда присутствует в городе, чем и привлекает отдыхающих из больших, динамичных городов. Поэтому поломки, беспорядок во дворах, потопы и прочие неприятности городские службы воспринимают как наказание небес и не торопясь, с молитвой, приступают к их устранению. Расценки на ЖКХ все же немалы, трехкомнатная квартира будет обходиться около 50 долларов в месяц.

В плане детских учебных заведений Саки может похвастать 6 школами и 8 детскими садами. Одна школа и сад расположены в поселке Новофедоровка. И в максимальной близости от каждого района города находятся школы и садики. Работает музыкальная школа с талантливыми преподавателями и центр детского творчества с широким спектром кружков.

Перспектив у городка множество. Туризм, лечение, химическое производство, сельское хозяйство и многое другое. Главное, чтобы кто-то их заметил и решил вложиться. Рабочие места нужны горожанам как воздух, Саки должны разрастаться, и не только в сторону моря.

Предприятия и работа в Саках

Работа — это сладкое слово для сакчанина. Особенно актуальна проблема трудоустройства осенью. Окончание летнего сезона приносит смуту в умы и ажиотаж на бирже труда. Хотя в Саках и функционируют крупные предприятия, но места там распределены заранее. Без проблем можно устроиться в ларек или палатку.

Сакский «Йодобром» выпускает продукцию для рынка Украины, России, Германии, Японии, Китая, Туркменистана. Работа ведется согласно международному стандарту качества ISO 9001-2009. Выпускается гидроскид алюминия, йода калий, различные антипирены, неорганические йодсодержащие продукты, коррозионностойкое оборудование из нержавеющей стали и многое другое. Специалисты, работающие на этом производстве, имеют высшее химическое, техническое или фармацевтическое образование. Проходят долгое обучение для работы в «Йодоброме».

Производственный цех Йодобром в Саках

Еще одно уникальное предприятие создает косметику на основе сакских грязей. Сакская гидрогеологическая станция производит уникальные средства, что реализуются в течение первых двух месяцев после производства и продаются только в Саках. Линейка средств достаточно широка, но объемы производства ограничены. Помимо образования, сотрудники станции должны иметь опыт работы и согласиться на скромный оклад.

Добыча грязи для производства косметики

Главные рабочие места в городке создают санатории и частные лечебные комплексы. Наиболее крупные здравницы расположены по улице Курортной, все остальные расположились с комфортом на берегу моря по улице с оригинальным названием Морская.

Детский санаторий «Голубая волна», круглогодичный комплекс «Полтава», здравница службы безопасности Украины «Парус» и частный комплекс «Юрмино» — это крупные санатории, создающие рабочие места в основном летом. Зарплата младшего медицинского и обслуживающего персонала колеблется от 200 максимум до 300 долларов. Специалисты с высшим образованием получают до 500 долларов.

Трудолюбивые граждане без амбиций найдут работу на пищевых производствах города. Молокозавод и хлебозавод работают постоянно и с хорошими объемами. Продукцию выпускают качественную и вкусную. Платят мало, около 200 долларов, но возможны бонусы в виде продукции.

Крепкие мужчины могут устроиться в карьер по добыче камня-ракушечника. Этот уникальный и экологичный строительный материал добывают глубоко в сакских степях. Работа сложная физически, но хорошо оплачивается. В месяц выходит до 1000 долларов.

Добыча ракушечника

Каждый крымчанин хоть раз работал в общепите. Найти работу официанта или повара в заведениях разного статуса в Саках можно круглый год. Заработок небольшой, зато стабильный. Колеблется в пределах 300-500 долларов в месяц.

Криминал

«Маленький Чикаго» на полуострове. Так называли город Саки в 90-х годах. Действительно, обстановка была накаленной. Легендарная группировка «Сейлем» была представлена и в Саках. Бритоголовые парни в костюмах «Адидас» отметились выстрелами, наглостью, «крышеванием» бизнесменов и дележкой территории с другими бригадами. Эпоха окончилась громкими криминальными делами и арестами.

В криминальной истории городка есть несколько громких убийств. Все они основаны на почве передела территорий и сфер влияния в 90-е. Так, в 1994 году был расстрелян предприниматель Александр Савич со своими телохранителями Андреем Бабенко и Владимиром Протасовым. Компания «Лотос», которой владел Савич, хотела начать строительство коттеджного комплекса на берегу моря. Но конкуренты своим способом помешали Савичу.

В 2008 был убит депутат и бизнесмен Олег Печерица. Убийство до сих пор не раскрыто, но предполагают, что это акт мести за прошлые дела.

Фото с места убийства Олега Печерицы

Маньяков или, не дай Бог, серийных убийц в Саках не было. Основным преступлением в городке является мелкая кража. Все уцелевшие бандиты приоделись в пиджаки и заимели депутатские мандаты. За последние 15 лет Саки из «Чикаго» превратился в провинциальный и спокойный уголок.

Достопримечательности Сак

Визитной карточкой города, несомненно, является Сакское соленое озеро. Концентрация соли в его водах составляет 230-250 г. на литр.

Соленое озеро

Иловые отложения озера (грязи) применяют для лечения широкого спектра заболеваний. Это различные костно-мышечные болезни, остаточные явления травм центральной нервной системы, артриты, остеоартриты, оститы, переоститы, шейно-лопаточный радикулит, бесплодие, простатит; заболевания ЛОР органов, болезни кожи и зубов. Само озеро в древности было морем, а теперь их разделяет широкая песчаная дамба, по которой в течение часа или двух можно добраться до морского побережья.

Сакское лечебное озеро

Еще одним даром города являются минеральные источники. Открыты они были в 1956 году, и сейчас работают два бювета с горячей карбонатно-хлоридно-натриевой водой. Ею лечат заболевания желудочно-кишечного тракта и болезни кожи. Набрать воду можно совершенно бесплатно.

Символ Сак — это памятник бронтозавру, что установлен между бюветом и лечебным озером. Знаменателен он тем, что это первый памятник динозаврам в мире. Установлен он был в 1932 году. В те годы повсеместно «ваяли» бюсты Ленина и Сталина, а тут «Борьба бронтозавра с цератозаврами»! Загадка его создания не расшифрована до сих пор. Горожане ласково называют его «бронтик» и считают символом первозданности и естественности происхождения целебных грязей и древности озера.

Сакский бронтик

Историческое и очень красивое место в Саках — это музей грязелечения. Расположен он в бывшей купеческой усадьбе 1912 года постройки. В нем собрана уникальная история грязелечения всего Крыма.

Музей истории грязелечения. Фото by khudoerkova.irina (http://fotki.yandex.ru/users/khudoerkova-irina/)

По дороге к морю, на высоком холме находится музей Кара Тобе. Этот музей является международным центром экспериментальной археологии и инновационной педагогики. При нем работает летний лагерь для детей и взрослых, параллельно проходят раскопки и отстраивается скифская деревня. В древности на этом месте распологалась крепость Евпаторион, потом проживали скифы, сарматы. Во время второй мировой войны на том холме находился немецкий дзот. Ничего удивительно в том, что столько народов многие века не покидали этого места, нет. С холма Кара Тобе виден почти весь Каламитский залив.

Музей Кара Тобе. Фото by qz1000000 (http://fotki.yandex.ru/users/qz1000000/)

Курортный городок может предложить и места для кулинарного отдыха. В Саках много заведений с восточной кухней, почти везде вас порадует понятное меню и приятные цены. К хорошим ресторанам можно отнести «Волшебную мельницу», «Зеленый мир» и «Элит», все они расположены в парковой, зеленой зоне.

Ресторан «Чаривный Млын»

И пускай в Сакском районе, селе Поповка, каждый год проходит культовый фестиваль «Казантип», сами Саки клубной столицей Крыма не назовешь. Летом клубов и дискотек становится больше, а вот в остальные времена года можно поплясать в заведениях «Эден» и «Кокос ICE». Ненавязчивый сервис, адекватные цены, музыка на любой вкус, и вы уже на волне «сакской сиесты».

Город Саки : Краткая справка о Саки

Саки — город-курорт в Крыму. Город Саки — центр Сакского района, но сам город в состав района не входит, а является одним из 11 городов республиканского подчинения. Находится на Западном побережье Крыма, центр города расположен в 5 км от Каламитского залива Черного моря, в 40 км от столицы Крыма Симферополя. Саки — старейший бальнеогрязевой курорт.

У южной границы города находится расположенное ниже уровня моря на 1,4 м соленое Сакское озеро. Оно мелководное, глубина в среднем около одного метра. Озеро площадью 560 га отделено от моря песчаной косой — пересыпью, шириной 640 м. Само озеро разделено земляными дамбами на семь изолированных водоемов, один из которых используется для добычи рапы и лечебных грязей.

Климат на курорте приморско-степной, засушливый, умеренно мягкий, с жарким летом и мягкой зимой. Средняя годовая температура воздуха +11,2°C. Средняя температура летних месяцев +22°C, зимних — около нуля. Продолжительность солнечного сияния в течение года в Саках — 2448 часов (в Москве — 1560).

Орган местной законодательной власти — Сакский городской совет, местная исполнительная власть — Сакская городская администрация. Площадь города 29 км2. Численность населения по данным на 2015 год — 25 195 человек (66% русских, 25% украинцев, 6,5% крымских татар, 2% белорусов). Часовой пояс UTC+3. Телефонный код +7 36563, почтовые индексы 296500-296509.

Герб

На современном (2005 года) гербе города Саки изображены символы четырёх цветов: голубого, красного, жёлтого и белого, они испокон веков используются в цветовой символике Крыма. Символы герба отображают историю Саки, его полезные ископаемые и уникальные природные данные.

В центре герба бронтозавр — символ города Саки, подчёркивающий древность Сакского лечебного озера. Треугольник – это гора соли, которая добывается в сакских окрестностях. А три звезды – напоминает нам о чумаках, которые в своё время перевозили соль Чумацким шляхом. Чаша с водой на голубом фоне в левом углу герба – это символ лечебной Сакской минеральной воды. Змея, овивающая посох, на красном фоне в правом углу герба символизирует Сакский бальнеологический курорт.

История

Когда впервые появилось поселение на месте нынешнего города Саки неизвестно. Во времена Крымского ханства Саки представляли собой небольшую деревню, входившую во владения знатного крымского рода Мансур.

В 1827 году в Саках была основана первая в России грязелечебница, а десять лет спустя здесь открылось отделение Симферопольского военного госпиталя.

В годы Крымской войны недалеко от Саки, между озерами Сакским и Кызыл-Яр, высадилась огромная армия войск коалиции, та самая, что держала многие месяцы в осаде Севастополь. А в начале февраля 1855 года здесь сосредотачивались войска генерала С.А.Хрулева перед штурмом укреплений неприятеля в Евпатории. Во время обстрела противником селение Саки было разрушено.

После Крымской войны в ходе второй волны эмиграции крымских татар Саки покинула большая часть крымскотатарского населения. Застраивался разрушенный и брошенный населением посёлок медленно. В 1858 году здесь поселились переселенцы из Полтавской губернии, позднее появились и греки, выходцы из Константинополя.

Во время гражданской войны, на восточном берегу озера Чокрак находилась ставка батьки Нестора Махно.

Проездом на ялтинскую конференцию в 1945 году в Саках останавливались президент США Ф.Д.Рузвельт и премьер-министер Великобритании У.Черчиль.

В 1952 Саки получил статус города. С 1954 года по 2014 город Саки, как и Крым в целом, входил в состав УССР, а с 1991 года — Украины. В 2014 Саки вошел вместе с Крымом в состав России.

Экономика

В городе находился один из крупнейших в Крыму химических заводов. Завод специализировался на выпуске перманганата калия, бромистого метила, персоли и поваренной соли. В 2002 году был остановлен из-за проблем с утилизацией отходов.

На базе артезианских источников (неокомский водоносный горизонт) работает завод по выпуску минеральной воды. В 1990 году завод розливал 40,9 млн бутылок, в 1994 — 16,7 млн бутылок. В Саках производится известная в Крыму и за его пределами минеральная вода «Крымская».

Перерабатывающая промышленность представлена Молокозаводом и Хлебокомбинатом.

В городе был основан и развивается НИИ прикладной химии с научной, конструкторской и экспериментально-промышленной базами по разработке технологии йодобромной промышленности и марганцевых соединений.

Транспорт

Через город проходят транспортные магистрали: автодорога республиканского значения и электрифицированная железная дорога (ветка Остряково-Евпатория). В городе есть автовокзал и железнодорожная станция. В 35 км от Саки (посёлок Аэрофлотский близ Симферополя) находится международный аэропорт, в 18 км (Евпатория) — грузопасажирский морской порт. Протяжённость городских дорог — 62 км. В городе действует 8 автобусных маршрутов.

Проехать в Саки из Симферополя и Евпатории можно пригородным электропоездом или рейсовым автобусом. Время в пути от Симферополя до Саки составляет около часа, от Евпатории — 30 минут.

Саки Крым

Саки

Саки – это лучший грязевой курорт и центр Сакского района, который расположен на западе Крымского полуострова. Саки находится в республиканском подчинении, как и еще одинадцать крымских городов. К сожалению, Саки не расположены на побережье Черного моря, однако до моря можно добраться, преодолев 5 километров. Город расположен на берегу Сакского озера в 20-ти километрах от детской здравницы, города Евпатория, и в 46 километрах от города Симферополя.

Координаты города Саки на карте Крыма GPS: N 45.12889434, E 33.57408450.

Саки сам по себе небольшой город, однако, популярен на весь мир как один из старейших бальнеологических курортов своими целебными грязевыми свойствами и прекрасным степным воздухом. Это прекрасное место чтобы оздоровиться и прекрасно отдохнуть на берегу Черного моря.

Климат города Саки умеренно-континентальный с незначительными температурными колебаниями и колебаниями давления воздуха, что позволяет круглый год принимать отдыхающих для лечения и оздоровления. Зима относительно мягкая, но ветреная и влажная. Лето жаркое, но не знойное за счет морских бризов и прибрежных ветров. Среднегодовая температура воздуха в городе составляет 11,3˚С тепла. Относительная влажность составляет 76%. В год количество осадков выпадает 350-400 мм.

Существует основные три фактора, которые влияют на климатические условия в городе Саки: степной рельеф, близость Черного моря и ветра. Одной из отличительных климатических характеристик является длительность солнечного сияния, которая составляет в городе Саки 2500 часов. Данный показатель является одним из наивысших в Крыму, так, например, в городе Ялта длительность солнечного сияния составляет 2223 часа.

Зима в Саках прохладная. Средняя температура воздуха составляет 0˚С…+1˚С. В зимний период преобладают северо-восточные ветра, которые приносят в город морозную и прохладную погоду. Самым холодным месяцем является февраль со средней температурой воздуха -1˚С.Лето солнечное и теплое, но не знойное. Средняя температура воздуха составляет +21˚С …+23˚С. В летний период времени преобладают юго-западные ветра. Они влекут за собой выпадение осадков и теплую погоду. Также в городе можно ощутить местные ветряные бризы, которые увлажняют и ионизируют воздух и не дают преобладать знойной погоде. В полдень данные ветра набирают максимальную скорость, а вечером успокаиваются в абсолютный штиль. Самым теплым месяцем является июль со средней температурой +23˚С. Купальный сезон начинает с конца мая и длится до конца сентября. Температура воды на этот период в среднем составляет +19˚С.

Численность населения города Саки составляет 22,5 тыс. человек. До 1989 года наблюдалось увеличение населения с каждым годом. А с 2001 года показатель численности населения пошел на спад. Подобная тенденция наблюдается по сей день.
В начале 19 века в городе преимущественно жили крымские татары. В 20 веке национальный состав изменился: русское население преобладало, в меньшей мере заселяли украинцы и крымские татары, а совсем незначительную часть составляли армяне и евреи. В 21 веке подобный национальный состав сохранился за исключением некоторых изменений: русские, украинцы, крымские татары, белорусы, поляки, молдаване. Русского населения проживает в городе Саки больше половины.В городе Саки действует завод минеральной воды, который расположен на минеральных источниках. Самая популярная торговая марка данного завода является «Крымская», которая известна на территории полуострова и за ее пределами.

До 2002 года в Саках действовал химический завод, который по своим масштабам был лидером на Крымском полуострове.
Так как Саки находится в близости с такими крупными городами как Евпатория и Симферополь, через него проходят железнодорожные пути, где ходят электрички и автодорога. С автовокзала можно уехать как за город, так и добраться в черте города Саки. Количество автобусных маршрутов насчитывается около шести.

Международный аэропорт находится в 37 километрах от города Саки. К санаториям и пансионатам можно добраться на автобусе, которые отправляются с автостанции и железнодорожного вокзала.Приезжая в маленький курортный городок Саки Вы не только отдохнете от ежедневной суеты, но и полюбуетесь местными красотами и непременно оздоровитесь за счет степного воздуха в сочетании с ароматными травами и целебными грязями. Так же недалеко от города находиться аквапарк Банановая республика, который дополнит отдых в Саках массой адреналина и удовольствием от катания на горках и отдыхая в бассейнах с прохладной водой под палящим Крымским солнцем.

Город Саки на карте Крыма

Историческая справка

Историческая справка.

Исторические указания и археологические раскопки подтверждают, что территория Сакского района была заселена с древнейших времён. Найдены погребения эпохи бронзы, таврские стоянки. В античный период (IV-II в. до н.э.) греки имели здесь свои колонии, вели добычу соли и вывозили её в Грецию. Греческие поселения относились к «дальней хоре» сельскохозяйственного округа города – полиса Херсонес.
После присоединения Крыма к России (1783г.) население Сакского района было смешанное, в его состав входили греки, татары и русские.
До 1935 г. населенные пункты современного Сакского района входили в состав Евпаторийского района. 26 января 1935 г. Президиум КрымЦИК принял постановление «Об образовании новой административной территориальной сети Крымской АССР», которым было обусловлено образование Сакского района. При организации района площадь его составляла 1396 кв.км. На этой территории располагалось 85 населённых пунктов, объединённых в 17 сельских советов.

Географическое расположение.

Сакский район – один из самых больших в Автономной Республике Крым, он занимает площадь 2,3 тыс.кв.км (8,5% территории Крыма), расположен в юго-западной части Крымского полуострова. Район граничит на севере с Раздольненским и Первомайским районом, на северо-западе – с Черноморским районом, на востоке с Красногвардейским и Симферопольским районами, на юге и юго-западе омывается Чёрным морем.
Численность населения Сакского района на 1.01.2004г. 79,6 тыс.чел. или 4 % населения Крыма.
Протяжённость района с востока на запад 130 км, с севера на юг 75 км.
Плотность населения в районе 35,3 чел. на 1 кв. км
Районным, административным и хозяйственным центром является город-курорт Саки, расположенный на юго-востоке района, на берегу Сакского озера. На территории района расположен город-курорт Евпатория. Через район проходит автодорога государственного значения Симферополь-Евпатория и однопутная электрифицированная железнодорожная линия Остряково-Евпатория. Расстояние от райцентра до областного центра г.Симферополя 45 км.

Характеристика рельефа, грунтов и гидрология.

Территория Сакского района расположена в степной части Крыма и представляет собой равнину, расчленённую балками и озёрами, вследствие чего она приобретает полого-волнистый характер. Максимальные абсолютные отметки поверхности составляют 80-100 м, снижаясь к морскому побережью.
Территория района отличается разнообразием почвообразующих пород. Это плотные карбонатные породы и их эловий, глины, лессы, современные морские и другие отложения. Наиболее распространены чернозёмы южные, чернозёмы на плотных глинах, чернозёмы щебнистые. Вдоль побережья моря во многих местах сформировались солончаки и солонцы. Характерной особенностью почв является недостаточность их увлажнения, что усугубляется суховеями, наряду с этим почвы подвержены эрозии, скелетности, засолённости.
Гидрографическая сеть региона крайне скудна. Вода, являясь минералом, представляет собой одно из ценнейших богатств Сакского района. В артезианских бассейнах равнинного Крыма находится 75 % эксплуатационных запасов пресных вод, относящихся к самому высокому классу по степени пригодности их использования.
К природным ресурсам Сакского района относятся залежи камня-ракушечника, гравия, песка, илово-сульфидные грязи, подземные минеральные воды.
На территории Сакского района нет рек и постоянных ручьев, имеются лишь озёра с горько-солёной водой. В прошлом это были низовья впадающих в море балок и рек, позже при опускании побережья полуострова море затопило эти низовья. Образовавшиеся заливы постепенно отделились песчаными пересыпями от моря и превратились в озёра. Озёра почти все мелководные (в среднем 1 м глубина). Главную роль в их питании играет морская вода, которая фильтруется через пересыпь.
На территории Сакского района большое количество соляных озёр (общая площадь 114,5 кв.км). Самые большие из них — Сасык-Сиваш, Донузлав, Кызыл-Яр, Богайлы, Ойбурское. Сасык-Сиваш — самое большое озёро Крыма, занимает площадь около 78 кв. км, с давних пор место добычи поваренной соли.

Климатические условия.

Климат Сакского района причерноморский степной, характеризующийся солнечным сухим летом, тёплой осенью и мягкой влажной зимой.
Средняя глубина промерзания грунтов достигает 25-30 см, наибольшая 50-60 см.
Преобладающим направлением ветра в тёплый период года является северо-восточное и юго-западное, в холодный период- северо-восточное. Максимальная скорость ветра ежегодно 27 м/сек, 32-34 м/сек один раз в 5-10 лет, 35-36 м/сек один раз в 15-20 лет.
Агроклиматические условия Сакского района характеризуются значительными тепловыми ресурсами: число дней со среднесуточной температурой выше 10 градусов составляет 190 дней. Однако, в вегетационный период отмечается недостаточное количество осадков (210 мм) и засухи (80 дней), приносящие ущерб сельскому хозяйству.
Климатические условия для рекреации способствуют развитию круглогодичного отдыха. По количеству солнечных дней – до 255 дней в году Сакский район опережает другие районы Крыма. Для зимнего периода характерны частые оттепели, отсутствие устойчивого снежного покрова, малая его высота – в среднем за зиму около 5 см.

Природно-ресурсный потенциал

Сакский район располагает богатыми природными ресурсами для организации отдыха и курортолечения: морской акваторией, берегами с пляжами, целебным приморско-степным климатом, лечебными водами и грязями.
Лечебно-минеральные воды представлены месторождениями в с.Фрунзе, с.Зерновое, а также проявлениями в с.Елизаветово, Ветровка, Луговое, Победное.
Производственный комплекс Сакского района сформировался в соответствии с его природными ресурсами и условиями и относится к аграрно-индустриальным. На территории района находится ряд карьеров, в которых добываются камень-ракушечник, щебень известняковый, песчано-гравийная смесь.
Лесные массивы (лесополосы) играют значительную роль в защите почв от ветровой и водной эрозии, являются источником накопления и сбережения влаги в почве, защищают посевы сельскохозяйственных культур и виноградники от неблагоприятных климатических условий.
Общая площадь лесонасаждений в районе составляет 3,5 тыс.га. Все леса искусственного происхождения. Основными породами деревьев являются: дуб черешчатый, орех грецкий, сосна крымская, гледичия, робиния псевдоакация, абрикосы, алыча.
Животный мир Сакского района отличается большим разнообразием. Некоторые виды встречаются в большом количестве. Популяция зайцев-русаков в некоторые годы достигает большой плотности. Из других пушных представителей фауны в небольшом количестве встречаются лисицы, степной хорек, ласка. Грызуны представлены 15 видами (суслик, хомяк, полевка и др.)
Среди птиц в Сакском районе многочисленны жаворонки, встречаются перепела, серые ку-
ропатки, редко – дрофы и фазаны. Повсеместно встречаются скворцы. Сезонно гнездятся и выводят потомство мигрирующие птицы – дрозды, утки, кулики и др. Из пресмыкающихся встречаются степная гадюка, уж и несколько видов ящериц.
Административное устройство
На территории Сакского района располагается 79 сел и 1 посёлок городского типа Новофёдоровка. Население района на 1.01.04г. составляет 79,6 тыс.жителей, в т.ч. 39 тыс. мужчин (49%) и 40,6 тыс.женщин (51%).
Местное самоуправление представлено 25 советами: районным, поселковым и 23 сельскими, в состав которых избрано 507 депутатов.

Рост численности населения зафиксирован в Керчи, Судаке и Саках

Ялта, 18 декабря. Крыминформ. Городское население Крыма за последние 13 лет увеличилось за счет прироста жителей Керчи, Судака и Сак. Это сегодня на пресс-конференции отметила руководитель Крымстата Ольга Балдина.

По ее словам, предварительные итоги переписи населения в Крымском федеральном округе показывают прирост городского населения, и если в Джанкое и Судаке это обусловлено перераспределением жителей в связи с изменением границ городского округа, то в Керчи — с развитием социальной инфраструктуры и строительством жилья. Отдельно Балдина выделила город Саки.

«Саки — едва ли не единственный город, который на протяжении последнего времени имеет естественный прирост населения, что не самая типичная ситуация для Крыма», — подчеркнула руководитель Крымсатата.

По предварительным итогам, наибольшее количество населения проживает в городском округе Симферополя – 350,6 тыс человек. На втором месте Керчь – 147 тыс человек, на третьем Ялта – 133,6 тыс человек, из которых 36,8% живут в южнобережных поселках. Численность населения Евпатории составляет 119,3 тыс человек, из них 11,4% проживают в поселках. Городской округ Феодосия насчитывает 101 тыс человек, причем 31,6% живут за чертой города. Практически половина из 52,3 тыс жителей Алушты проживает в поселках /44,4%/. Такая же тенденция наблюдается в Судаке, где из 32,3 тыс жителей 48,9% составляет сельское население. Горожанами являются 38,6 тыс жителей Джанкоя, 26,3 тыс Красноперекопска и 25,1 тыс Сак. Самый малонаселенный городской округ — Армянск: 24,4 тыс человек, из которых 9,9% проживают за чертой города.

Среди районов лидером по количеству населения является Симферопольский муниципальный район – 152,1 тыс человек. На втором месте Бахчисарайский муниципальный район, где из 90,9 тыс жителей 30,2% проживает в городе Бахчисарай. На третьем – Красногвардейский район с 83,2 тыс жителей. В селах Сакского района проживают 76,4 тыс человек, Джанкойского – 68,3 тыс человек, в Ленинском – 61,2 тыс человек, из которых 17,4% составляют жители города Щелкино. Белогорский муниципальный район насчитывает 60,4 тыс жителей, из которых 27,1% проживает в городе Белогорск. Численность населения Кировского района составляет 50,8 тыс человек, из них 18,2% проживают в городе Старый Крым. В селах Нижнегорского района проживают 45,1 тыс человек, Первомайского – 32,8 тыс человек, Советского – 31,9 тыс человек, Раздольненского – 30,6 тыс человек, Черноморского – 30,5 тыс человек, Красноперекопского – 24,7 тыс человек.

Всего в Крымском федеральном округе 57,9 % населения, или 1 млн 323 тыс человек составляют жители городов, и 42,1%, или 961,4 тыс человек – сельские жители. Из них в городских округах Республики Крым проживают 958,2 тыс человек, в районах — 931,2 тыс человек.

Города-побратимы — Официальный Интернет-портал органов местного самоуправления городского округа Саки

Заключение побратимских соглашений положительным образом сказывается на деловом и культурном имидже города-курорта Саки, способствует укреплению дружбы и добрососедства между государствами. Осуществляются взаимные обмены делегациями, проводятся деловые встречи, совещания по реализации проектов, имеющих немаловажное значение для нашего города, участие в спортивных состязаниях и др.

Ежегодно из городов-побратимов приезжают гости на открытие курортного сезона и День города.

В музее истории грязелечения г.Саки (ул. Курортная, 21) находятся подарки — картины, книги, буклеты, изделия мастеров декоративно-прикладного искусства городов-побратимов, благодаря чему сакчане и гости города могут узнать много интересного об истории и культуре городов-побратимов.
Перспективное сотрудничество год от года расширяется.


Братск

Братск расположен на северо-западе Иркутской области в центральной части Ангарского кряжа. Город возник в 1955 году, в связи со строительством Братской ГЭС, севернее старинного посёлка Братск (Брацк), основанного как острог в 1631 году.

Сегодня Братск является одним из крупнейших промышленных центров Приангарья.

Население города — 234 147 чел. (2016).

Тобольск

Туристический сайт города:  http://tobolsktravel.ru/ru

Тобо́льск — город в Тюменской области России. Административный центр Городского округа город Тобольск. Ранее административный центр Тобольского района, Тобольского округа, Тобольского уезда. После муниципальной реформы на городской территории находится лишь администрация соседнего муниципалитета.

Расположен на севере Тюменской области, в месте впадения реки Тобол в Иртыш.

Основан в 1587 году как центр освоения Сибири. В 1590 году Тобольск первым в Сибири получил статус города.

Урай

Урай — город в России, в Ханты-Мансийском автономном округе — Югре.

Население — 40 477 чел. (2016).

Урай является моногородом. Основное нефтегазодобывающее предприятие «Урайнефтегаз» входит в состав нефтяной компании «Лукойл». В городе начинается нефтепровод Шаим — Тюмень.

Удачный

Расположен в 22 км южнее Северного полярного круга, в верховьях реки Мархи, в 1100 км от Якутска, в 411 км от Мирного. Город состоит из двух районов — Надёжный и Новый город. В 21 км от Удачного расположен аэропорт «Полярный».

Удачный возник в 1967 году как посёлок в связи с началом промышленных разработок месторождения кимберлитовой трубки «Удачная».

В 1987 году получил статус города.

Первый микрорайон — посёлок Удачный (Старый Удачный) — полностью ликвидирован в 1998 году. В данный момент ликвидирован Полярный, расселяется с этой же целью микрорайон Надёжный.

Зеленогорск

В 1994 году Зеленогорский район был упразднён и включён в состав Курортного района Санкт-Петербурга. В 1997 году Зеленогорск получил статус отдельного городского муниципального образования в составе объединённого Курортного района.

Вельс (Австрия)

Старинный австрийский город на северо-западе страны. Население города – более 56 тыс. человек. Через Вельс проходит железнодорожная магистраль Вена —Зальцбург. Со средних веков сохранилась традиция проведения больших Вельсских ярмарок раз в два года.
Партнерство двух городов началось в 1998г. Меморандум о продлении сотрудничества подписан в апреле 2012 г.

Вадул луй Водэ (Республика Молдова)

Расположен на правом берегу Днестра в 23 км от Кишинёва.Город – курорт Молдовы. Население – 4,8 тыс. человек.
Договор о сотрудничестве подписан в июне 2013 года.

Грозный (Чеченская Республика)

Один из крупных городов Северного Кавказа. Столица Чечни. Второе место по площади и третье место по населению: 277 414 человек.
Дружественные связи были установлены в октябре 2009 года.

Ессентуки (Ставропольский край)

Ессентуки – долина нарзанов Ессентуки – входит в группу Кавказских Минеральных Вод, расположен на высоте 640 м над уровнем моря, в долине реки Подкумок.
В Ессентуках нет ни скал, ни водопадов, ни лесов. Зато город гордится обширными парками. Функционирует свыше 30 санаториев и пансионатов.
Среди природных памятников Ессентуков – знаменитые Плачущие Гроты.
В городе проживает около 81,7 тыс. человек.
Соглашение о сотрудничестве и побратимстве заключено в июне 2014 года.

Ливны (Орловская область)

Городской округ «Город Ливны» является административным центром Ливенского муниципального района. Второй по величине и экономике город области. Признан одним из самых благоустроенных городов России III категории. Население – 49342 чел.
Договор о побратимстве действует с июня 2009 года.

Назрань (Республика Ингушетия)

Крупнейший город Республики, расположен на западе Чеченской предгорной равнины. Был столицей Ингушетии до 2000 года. Население – 102471 человек.
Соглашение о сотрудничестве подписано в апреле 2014 года.

Протвино (Московская область)

Город областного подчинения, приблизительно в 15 км к западу от Серпухова и 98 км к югу от МКАД. С 2008 года имеет статус наукограда России. Население города — 37 492 чел.
Официальные связи установлены в 2007 году.

Судак (Республика Крым)

Приморский город республиканского подчинения в юго-восточном Крыму.
Традиционный центр производства вин и курорт, с трех сторон его окружают живописные горы. Население города – 15 368 человек.
Дружественные связи существуют с июля 2011 года.

Фетхие (Республика Турция)

Район и город-курорт на юго-западе Турции. Расположен у подножия гор, покрытых сосновыми и кедровыми лесами, в 40 километрах от аэропорта Даламан. Современный город лежит на месте античного порта Телмес, который ведет свою историю с 5-4 веков до нашей эры. Население — 84 тыс. человек.
Город-побратим с мая 2008 года.

Центральный район г. Гомеля (Республика Беларусь)

Административно-территориальная единица (городской район) в составе города Гомеля. Население района – более 100 тыс. человек. В районе расположены предприятия практически всех отраслей промышленности: машино- и приборостроение, легкая, пищевая, полиграфическая, деревообрабатывающая промышленность.
В 2007 году подписан Договор о побратимстве, культурном и экономическом сотрудничестве.

Цюнхай (провинция Хайнань, Китай)

Хайнань — второй по величине (после Тайваня) остров на юге Китая. Население провинции составляет 8671518 человек. Важнейший город провинции – Цюнхай. Основные индустрии города – машиностроение, добыча полезных ископаемых, сахара, стройматериалы и пищевая промышленность.
Соглашение об установлении побратимских связей заключено в декабре 2012 года.

Щигры (Курская область)

Город расположен на реке Щигор, в 61 км к северо-востоку от Курска.
Входит в Перечень исторических городов России. Население— 17 043 чел. Чистые улицы, ухоженные памятники. Недавно до конца восстановлена архитектурная жемчужина Щигров – Свято-Троицкий храм XVIII века.
Протокол об установлении побратимских связей в торгово-экономической, научно-технической и гуманитарно-культурной областях подписан в июне 2008 года.

Саки билеты на самолет. Погода, валюта, код страны и местное время в Саки.

Саки

Саки — город, в котором нет аэропорта, тем не менее до него легко добраться: долететь самолётом до одного из близлежащих крупных городов с аэропортами, а оттуда уже до города Саки.

Крупные города рядом

Саки находится недалеко от следующих городов:

Симферополь — 44.31 км
Севастополь — 49.24 км
Херсон — 187.14 км
Керчь — 224.59 км
Николаев — 249.44 км.

Аэропорты рядом

От города можно легко добраться до следующих аэропортов:

Симферополь — 39.13 км
Бельбек — 49.24 км
Херсон — 190.53 км
Николаев — 249.44 км.

Расписание самолётов в город Саки

Авиабилеты до города Саки не продаются, потому что в городе нет своего аэровокзала. Но рядом с городом находятся аэропорты, перечисленные выше.

Саки: отели

Подберите оптимальный вариант проживания в городе Саки или крупных городах, расположенных рядом с городом Саки, на hotels.anywayanyday.com: ищите отели по цене, популярности, рейтингу путешествеников, типу проживания и наличию определенных услуг. Кроме того, помните, что за каждое отельное бронирование на Anywayanyday вы получаете скидку до 10% на покупку авиабилетов на нашем сайте.

Ищите на hotels.anywayanyday.com отели не только в городе, но и по всему региону, в котором находится город Саки.

Саки: общая информация

Население города — 28322 человек.

Широта — 45.13424.

Долгота — 33.59996.

Страна

Город Саки находится в Украине.

Площадь Украины — 603700 кв.м.

Население Украины — 45872000 человек.

Плотность населения Украины — 45872000.

Телефонный код Украины — 380.

Валюта Украины — UAH.

Языки Украины — украинский.  

Регион

Саки расположен в регионе .

Население региона — человек.

Широта: .

Долгота: .

Популярные направления:

Авиабилеты из Москвы в Санкт-Петербург

Авиабилеты из Санкт-Петербурга в Москву

Авиабилеты из Москвы в Симферополь

Авиабилеты из Симферополя в Москву

Авиабилеты из Сочи в Москву

Авиабилеты из Москвы в Сочи

Авиабилеты из Москвы в Киев

Авиабилеты из Киева в Москву

Авиабилеты из Москвы в Минеральные Воды

Авиабилеты из Минеральных Вод в Москву

Авиабилеты из Москвы в Краснодар

Авиабилеты из Краснодара в Москву

Авиабилеты из Москвы в Ростов на Дону

Авиабилеты из Ростова на Дону в Москву

Авиабилеты из Москвы в Екатеринбурга

Авиабилеты из Екатеринбурга в Москву

Авиабилеты из Мюнхена в Москву

Авиабилеты из Москвы в Стамбул

Авиабилеты из Москвы в Мюнхен

Авиабилеты из Стамбула в Москву

Авиабилеты из Франкфурта в Москву

Авиабилеты из Москвы в Париж

Авиабилеты из Москвы в Ереван

Авиабилеты из Парижа в Москву

Авиабилеты из Москвы в Кишинёв

Авиабилеты из Москвы в Франкфурта

Авиабилеты из Москвы в Тель-Авив

Авиабилеты из Москвы в Ригу

Авиабилеты из Риги в Москву

Авиабилеты из Тель-Авива в Москву

Саки, Нигерия Население в районе метрополитена 1950-2021 гг.

Диаграмма и таблица уровня населения и темпов прироста для района метро Саки, Нигерия, с 1950 по 2021 год. Прогнозы Организации Объединенных Наций в области народонаселения также включены на период до 2035 года. Увеличение на 5,05% по сравнению с 2020 годом.
  • Население метро Саки в 2020 году составляло 376 000 , а 5.На 03% больше по сравнению с 2019 годом.
  • Население агломерации Саки в 2019 году составляло 358 000 , что на 4,99% больше, чем в 2018 году.
  • Население агломерации Саки в 2018 году составляло 341 000 , что на 5,25% больше, чем в 2017 году.
  • Другие города в Нигерии
    Название города Население
    Лагос 14 862 000
    Кано 4 103 000
    Ибадан 3 649 000
    Абуджа 3 464 000
    Порт-Харкорт 3 171 000
    Бенин Сити 1,782,000
    Онитша 1 483 000
    Uyo 1,200,000
    Кадуна 1,133,000
    Аба 1,114,000
    Nnewi 1,114,000
    Икороду 989 000
    Илорин 974 000
    Jos 917 000
    Оверри 908 000
    Варри 899 000
    Умуахия 817 000
    Майдугури 803 000
    Энугу 795 000
    Локоя 741 000
    Заря 736 000
    Ошогбо 731 000
    Акуре 691 000
    Сокото 662 000
    Баучи 621 000
    Калабар 605 000
    Абакалики 602 000
    Огбомошо 577 000
    Abeokuta 544 000
    Гомбе 529 000
    Адо-Экити 497 000
    Кацина 487 000
    Окене 478 000
    Игбиду 465 000
    Минна 463 000
    Окпого 461 000
    Гбоко 456 000
    Потискум 455 000
    Ондо 445 000
    Gwagwalada 443 000
    Ойо 441 000
    Макурди 422 000
    Икот Экпене 398 000
    Эффон Алайе 396 000
    Саки 395 000
    ИФЭ 385 000
    Бирнин Кебби 381 000
    Илеша 371 000
    Иджебу-Одэ 356 000
    Lafia 348 000
    Саки — Исторические данные о населении
    Год Население Скорость роста
    2021 395 000 5. 05%
    2020 376 000 5,03%
    2019 358 000 4,99%
    2018 341 000 5,25%
    2017 324 000 5,19%
    2016 308 000 5.12%
    2015 293 000 5,02%
    2014 279 000 5,28%
    2013 265 000 5,16%
    2012 252 000 5,00%
    2011 240 000 5.26%
    2010 228 000 5,07%
    2009 217 000 5,34%
    2008 206 000 5,10%
    2007 196 000 5,38%
    2006 186 000 5.08%
    2005 177 000 4,73%
    2004 169 000 5,62%
    2003 160 000 4,58%
    2002 153 000 5,52%
    2001 145 000 5.07%
    2000 138 000 5,34%
    1999 131 000 4,80%
    1998 125 000 5,04%
    1997 119 000 5,31%
    1996 113 000 5.61%
    1995 107 000 4,90%
    1994 102 000 5,15%
    1993 97 000 5,43%
    1992 92 000 4,55%
    1991 88 000 3.53%
    1990 85 000 3,66%
    1989 82 000 2,50%
    1988 80 000 3,90%
    1987 77 000 4,05%
    1986 74 000 2. 78%
    1985 72 000 4,35%
    1984 69 000 2,99%
    1983 67 000 4,69%
    1982 64 000 3,23%
    1981 62 000 3.33%
    1980 60 000 3,45%
    1979 58 000 3,57%
    1978 56 000 3,70%
    1977 54 000 3,85%
    1976 52 000 4.00%
    1975 50 000 2,04%
    1974 49 000 4,26%
    1973 47 000 4,44%
    1972 45 000 2,27%
    1971 44 000 4.76%
    1970 42 000 2,44%
    1969 41 000 2,50%
    1968 40 000 5,26%
    1967 38 000 2,70%
    1966 37 000 2.78%
    1965 36 000 5,88%
    1964 34 000 3,03%
    1963 33 000 3,13%
    1962 32 000 3,23%
    1961 31 000 3.33%
    1960 30 000 3,45%
    1959 29 000 3,57%
    1958 28 000 3,70%
    1957 27 000 3,85%
    1956 26 000 4.00%
    1955 25 000 4,17%
    1954 24 000 4,35%
    1953 23 000 0,00%
    1952 23 000 4,55%
    1951 22 000 4. 76%
    1950 21 000 0,00%

    Ойо (штат, Нигерия) — Статистика населения, диаграммы, карта и местоположение

    Штат в Нигерии

    Содержание: Подраздел

    Развитие населения в Ойо, а также соответствующая информация и услуги (Википедия, Google, изображения).

    Значок указывает на дополнительную информацию о выбранном подразделении, включая его структуру населения (пол, возрастные группы, возрастное распределение).

    le 65 Акин le 65 Акин 91 117 Юго-Западный Ибадан 127,391
    Имя Статус Население
    Перепись
    1991-11-26
    Население
    Перепись
    21.03.2006
    Население
    Прогноз
    21.03.2016
    Oyo Штат 3,452,720 5,580,894 7,840,900
    Афиджио Район местного самоуправления 82,792 132,184 185,700
    211811 297 600
    Атиба Район местного самоуправления 168 246 236 400
    Атисбо Район местного самоуправления 109,965 154 500
    Эгбеда Район местного самоуправления 129,461 283,643 398,500
    Северный Ибадан Район местного самоуправления 302,271 308,119 432,900
    Ибадан Северо-Восток 270045 465,700
    Ибадан Северо-Запад Район местного самоуправления 147,918 154,029 216,400
    Юго-Восток Ибадана Район местного самоуправления 225,800,4570045
    Район местного самоуправления 277 047 283098 397 700
    Центральный Ибарапа Район местного самоуправления 103243 145,100
    Восточный Ибарапа Район местного самоуправления 117,182 164 600
    Северный Ибарапа Район местного самоуправления . .. 100,293 140,900
    Ido Район местного самоуправления 53,582 104,087 146,200
    Ирепо Район местного самоуправления 121,240 170,300
    Исэйин Район местного самоуправления 170,936 255,619 359,100
    Итесиважу Район местного самоуправления 179,000
    Иваджова Район местного самоуправления 102,847 144,500
    Каджола Район местного самоуправления 200,528 281,700
    Лагелу Район местного самоуправления 68,901 148,133 208,100
    Огбомошо Северный 104,245 19845 279,400
    Южный Огбомошо Район местного самоуправления 65,958 100,379 141,000
    Ого Олува Район местного самоуправления 36,18800 91
    Олорунского Район местного самоуправления 81,339 114,300
    Олуйоле Район местного самоуправления
    203,461 285,900
    Она-Ара Район местного самоуправления 123,045 265,571 373,100
    Орелоп Район местного самоуправления 68,566 104,004 146,100
    Ире Район местного самоуправления 103,611
    Восток Ойо Район местного самоуправления 124,095 174,300
    Ойо-Вест Район местного самоуправления 136,457 191,700
    Восточный Саки Район местного самоуправления . .. 108,957 153,100
    Саки Западный Район местного самоуправления 273268 383,900
    Сурулере Район местного самоуправления 64,097 900 140,339 197,200
    Нигерия Федеративная Республика 88,992,220 140,431,790 193,392,500

    Источник: Национальная комиссия по народонаселению Нигерии Статистика (Интернет).

    Пояснение: Демографический прогноз предполагает одинаковые темпы роста для всех LGA в пределах штата. Недоучет переписи 1991 года оценивается примерно в 25 миллионов человек. Все данные о населении Нигерии показывают высокий уровень ошибок; Результаты переписи оспариваются. Показатели площади рассчитываются с использованием геопространственных данных.


    Дополнительная информация о структуре населения:

    Пол (C 2006)
    Мужчины 2,802 432
    Женщины 2,778,462
    Возрастные группы (C 2006)
    0-14 лет 2,099,694
    15-64 года 3,267,397
    65+ лет 213,803
    Распределение по возрасту (C 2006)
    0-9 лет 1,443,194
    10-19 лет 1,252,424
    20-29 лет 1,047,008
    30 -39 лет 713,492
    40-49 лет 500,551
    50-59 лет 296,924
    60-69 лет 177,194
    70-79 лет 87,065
    80+ лет 63042

    О национальной инициативе по созданию комплектов для сексуального насилия

    Национальная инициатива по созданию комплектов для сексуального насилия (SAKI) предоставляет финансирование через конкурсную программу грантов для поддержки юрисдикционной реформы подходов к делам о сексуальных домогательствах, являющихся следствием доказательств, обнаруженных в наборах для сексуального насилия (SAK), которые никогда не были отправлены в криминалистическую лабораторию.SAKI находится в ведении Бюро по оказанию помощи в правосудии (BJA) и направлено на создание скоординированных ответных действий сообщества, которые обеспечивают справедливое разрешение дел о сексуальных домогательствах посредством (1) комплексного подхода, ориентированного на потерпевших, (2) наращивания юрисдикционного потенциала для предотвращения большого числа неотправленных SAK в будущем, и (3) поддержка расследования и судебного преследования дел, по которым ранее не были представлены SAK. Сайты SAKI, как в настоящее время, так и ранее финансируемые, составляют примерно 57% от общего числа пользователей U.С. Население (328,2 млн. Человек).

    Почему SAKI так важен?

    SAKI имеет решающее значение для усиления реакции уголовного правосудия на сексуальные посягательства и обеспечения справедливости для жертв. Финансирование SAKI не только поможет связать жертв с защитниками и необходимыми услугами, но также поможет юрисдикциям внедрить передовой опыт и провести всеобъемлющую реформу, чтобы помочь привлечь виновных к ответственности и повысить безопасность в сообществах, предотвращая сексуальные посягательства в будущем.

    В настоящее время нет достоверной оценки количества комплектов для нападений на сексуальной почве (SAK), которые не были переданы в криминалистическую лабораторию; однако причины отставания сложны.Непредставленные SAK могут быть объяснены многими факторами, в том числе плохим отслеживанием доказательств, устаревшими и неэффективными методами расследования, нехваткой ресурсов и персонала, непониманием политик принятия уголовных дел и непониманием сотрудниками правоохранительных органов ценности тестирования SAK. 1,2 Решение этих проблем имеет решающее значение для обеспечения правосудия для жертв и предотвращения такого отставания в будущем.

    Программа обучения и технической помощи SAKI

    Программа обучения и технической помощи (TTA) Инициативы по борьбе с сексуальным насилием (SAKI), возглавляемая RTI International и в партнерстве с группой профильных экспертов, предлагает экспертные знания и помощь юрисдикциям, поскольку они создают широко распространенные, основанные на фактах, устойчивые практики для:

    • Сбор и обработка доказательств,
    • Расследование и судебное преследование по делам о сексуальных домогательствах на основании доказательств из ранее не представленных комплектов сексуального насилия (SAK), и
    • Поддержка переживших сексуальное насилие.

    В сотрудничестве с текущими усилиями, предпринимаемыми Управлением программ правосудия и заинтересованными организациями, команда SAKI TTA будет оказывать помощь в разработке, внедрении и распространении передовых практик, политик и протоколов для решения системных проблем, которые приводят к большому количеству неотправленные комплекты и предотвращение повторения этих проблем в будущем.

    Команда TTA будет эффективно распространять публикации и комплекты ресурсов, в которых рассматриваются извлеченные уроки, общие проблемы и лучшие практики, полученные на основе опыта получателей грантов SAKI.

    Загрузите последний информационный бюллетень по обучению и технической помощи SAKI

    Области фокусировки

    Междисциплинарный ответ: Эффективные методы, включая создание и поддержание устойчивой SART.

    Правоохранительные органы: Определение следственных действий, которые необходимо предпринять после попадания в CODIS (комбинированная система индекса ДНК), определение приоритетности нескольких совпадений CODIS, составление политики и процедур по стандартам расследования, сбор и обработка доказательств, а также управление расследованиями.

    Обвинение: Преодоление трудностей, связанных с судебным преследованием по негласным делам, обучение подготовке и допросу свидетелей, а также представление доказательств сексуального насилия в суде.

    Медсестры, занимающиеся вопросами сексуального насилия (SANE): Выявление потребностей, пробелов и проблем в местной программе SANE и определение роли SANE в случаях сексуального насилия.

    Криминалистика и анализ преступлений: Предлагает ценный опыт в области тестирования SAK, включая судебную генеалогию, анализ преступлений и другие передовые методы судебной экспертизы ДНК.

    Защита интересов потерпевших и их семей: Предоставление ориентированных на потерпевших и основанных на травмах практик, которые улучшают участие потерпевших и их семей в системе уголовного правосудия.

    Управление делами: Предлагает услуги, связанные с подключением систем управления информацией криминалистических лабораторий к расследованиям и судебным преследованиям.

    Команда SAKI

    Бюро помощи в правосудии (BJA)
    BJA обеспечивает руководство и услуги в области выдачи грантов и разработки политики в области уголовного правосудия.В консультации с Национальным институтом юстиции, Управлением по делам жертв преступлений и Управлением по борьбе с насилием в отношении женщин BJA создало SAKI для удовлетворения различных потребностей юрисдикций, которые борются с проблемами, возникающими из-за непредставленных комплектов сексуального насилия (SAK).

    Персонал проекта BJA

    • Анжела Уильямсон, доктор философии, руководитель отдела криминалистики / ФБР по связи с ViCAP, контактное лицо (POC) для сайтов SAKI
    • Кэри Хендрикс, советник по политике, отдел судебной экспертизы
    • Мила Хаго и Лорен Трой, советники по государственной политике, контактные лица по программированию сайтов SAKI

    RTI International
    RTI — это частная некоммерческая исследовательская организация со штаб-квартирой в Research Triangle Park, NC.RTI обладает всесторонними знаниями в области судебно-медицинской экспертизы, деятельности правоохранительных / судебно-медицинских лабораторий и оценки политики / программ. RTI служит основным контактным лицом для всех сайтов SAKI, сотрудничает с партнерами SAKI TTA, управляет TTA и распространяет передовой опыт.

    POC:

    • Кевин Стром, доктор философии, главный исследователь
      Доктор Стром руководил многочисленными крупномасштабными и сложными проектами в области полицейской деятельности и судебной медицины, в том числе исследованиями, сфокусированными на неотправленных и скрытых доказательствах.В SAKI TTA он курирует и направляет команду TTA для достижения целей SAKI TTA.
    • Патрисия Мелтон, доктор философии, соруководитель исследования
      Доктор Мелтон имеет опыт разработки и передачи знаний в области судебно-медицинской экспертизы ДНК специалистам правоохранительных органов, юристов, криминалистов и медиков. В SAKI TTA она работает с доктором Стромом, чтобы управлять результатами проекта и координировать деятельность.
    • Нани Гриммер, руководитель программы
      РС.Гриммер помогает в управлении финансами, соблюдении требований грантов и управлении проектами.
    • Кристал Дэй, координатор Зоны
      Г-жа Дайе помогает в разработке и обзоре материалов проекта и выступает в качестве основного контактного лица для партнеров с запросами о доставке TTA.
    • Аманда Янг, координатор
      Г-жа Янг помогает с созданием и анализом результатов проекта и выступает в качестве ведущего члена команды для всех коммуникационных мероприятий.
    • Джим Марки, старший специалист по обучению сотрудников правоохранительных органов
      (В отставке) сержант. Марки проводит обучение следователей правоохранительных органов по вопросам сексуальных преступлений, допросов и допросов, анализа ДНК и непроверенных доказательств, а также расследования нераскрытых дел. Он служил в отделении полиции Феникса (Аризона) 30 лет.
    • Андре Ричардс, сотрудник правоохранительных органов
      Г-н Ричардс имеет более чем десятилетний опыт работы в правоохранительных органах с департаментом полиции Дарема (Северная Каролина) и помогает в реализации инициатив правоохранительных органов.
    • Пейтон Аттэуэй, Джулия Бринтон, Сара Кук, Кристал Дэй, Кэтрин Гринвелл, Рут Гроссман, Лиза Малетт, Девин Окснер, Пейдж Преслер-Джур, Андре Ричардс, Элиша Тайс, а также Крис Уильямс и Аманда Янг, координаторы сайта.
      Вышеуказанные представители по связям с сайтами адресуют запросы и запросы с сайтов SAKI.

    Партнеры группы обучения и технической поддержки SAKI

    AEquitas
    Миссия AEquitas — улучшить качество правосудия в делах о сексуальном насилии, насилии со стороны интимного партнера, преследовании и торговле людьми.Для SAKI TTA AEquitas оказывает помощь в разработке политики и передовых методов, а также способствует обучению по судебному преследованию по делам о сексуальных домогательствах.

    POC:

    • Кристина Супински, главный операционный директор, первичный контактный адрес
    • Патрисия Пауэрс, советник юриста, вторичный POC

    Международная ассоциация начальников полиции (IACP)

    IACP предоставляет обучение, моделирование политики и образовательные инструменты для поддержки сотрудников правоохранительных органов, системы уголовного правосудия и партнеров по сообществу.Для SAKI TTA IACP предоставляет помощь в выявлении и разработке практик, процедур и обучения для усиления подходов, ориентированных на интересы жертв.

    POC:

    • Эми Дуралл, менеджер проекта, первичный контактный телефон
    • Дэйв Томас, менеджер программы, вторичный контактный телефон

    Университет штата Мичиган
    Доктор Ребекка Кэмпбелл, профессор психологии в Университете штата Мичиган, является признанным на национальном уровне тренером-практиком по сексуальному насилию и неврологии травм.Роль доктора Кэмпбелла в SAKI TTA заключается в предоставлении помощи в разработке стратегий, планов тестирования, протоколов уведомления жертв и обучении.

    Медсестра-экзаменатор по делам о сексуальном насилии (SANE) —SART Resource Service
    Ресурсная служба SANE-SART обладала опытом в создании многопрофильных команд и SART. Его роль SAKI TTA заключалась в оказании помощи в разработке политик, процедур, передового опыта и учебных программ.

    POC:

    • Линда Ледрей, RN, SANE-A, PhD, FAAN

    Проект: Холодный ящик
    Project: Cold Case со штаб-квартирой в Джексонвилле, Флорида, специализируется на защите интересов жертв и семей лиц, пострадавших от насильственных преступлений, таких как сексуальное насилие и убийство.Райан Бакманн ведет тренинги и информационные презентации по всей стране, посвященные прежде всего негласным случаям насильственных преступлений.

    POC:

    • Райан Бакманн, основатель и исполнительный директор

    Фонд «Радостное сердце»
    Миссия фонда «Радостное сердце» — изменить реакцию общества на сексуальное насилие, насилие в семье и жестокое обращение с детьми, поддержать исцеление выживших и навсегда положить конец этому насилию.

    POC:

    • Ильзе Кнехт, директор по вопросам политики и защиты интересов

    Национальная сеть изнасилований, жестокого обращения и инцеста (RAINN)
    RAINN — это крупнейшая в стране организация по борьбе с сексуальным насилием и национальный лидер в сфере онлайн-услуг по оказанию помощи в кризисных ситуациях.Роль RAINN SAKI TTA заключается в предоставлении помощи в разработке подходов, ориентированных на интересы жертв, для юрисдикций.

    POC:

    • Камилла Купер, вице-президент по государственной политике
    • Эрин Эрп, Совет по законодательной политике

    Партнерство по программе задержания насильственных преступников (ViCAP)

    В начале 2017 года команда BJA SAKI объединилась с ViCAP, чтобы расширить использование базы данных и обмен разведданными о преступлениях по делам, связанным с SAKI, в разных юрисдикциях и стране.Сотрудники ViCAP готовы помочь сайтам войти в систему; провести обучение по оптимальному использованию базы данных; и проводить анализ преступлений по конкретным правонарушителям / делам по запросу. Кроме того, у ViCAP есть назначенный аналитик SAKI, который оказывает непосредственную помощь нашим сайтам. Дополнительную информацию о ViCAP, включая определение «критериев», см .: Программа по задержанию преступников с применением насилия (ViCAP)

    ADW: Pithecia pithecia: ИНФОРМАЦИЯ

    Географический ареал

    Белолицые саки (Pithecia pithecia) обитают в Бразилии и отдаленных частях Венесуэлы.Их ареал также охватывает большую часть Французской Гвианы, Гайаны и Суринама. Они живут вдоль бассейна реки Куюни, к востоку от реки Карони и к югу от реки Ориноко. (Вейга и Марш, 2008 г.)

    Место обитания

    Белолицые саки произрастают на деревьях и живут как в высокогорных, так и в низинных тропических лесах. Хотя они могут населять очень влажные и очень сухие леса, они предпочитают районы с множеством фруктовых деревьев и водопоев. Этот вид чаще всего встречается на высоте полога от 15 до 25 м.Они также будут искать корм на земле и на низких уровнях в листве подлеска (от 3 до 15 м). Места для ночлега обычно представляют собой большие деревья под навесом с обильной листвой для укрытия. (Anzelc, 2009; Cunningham and Janson, 2007)

    Физическое описание

    Белолицые саки демонстрируют половой диморфизм с более крупными самцами и половой дихроматизм. У самцов черная шерсть с белым мехом, который окружает их лицо. У самок саки более короткая коричневато-серая шерсть с двумя вертикальными линиями от глаз до носа.У самок также может быть оранжево-коричневый мех, который появляется вокруг груди и продолжается до живота. При рождении самцы и взрослые самки внешне очень похожи. Происходит постепенное изменение цвета в течение 3,5–4 лет, при котором саки-самцы становятся полностью черными с ярко-белыми лицами. У саков длинные пушистые хвосты, которые используются для баланса при прыжках с дерева на дерево. Хвосты не используются для захвата предметов или веток. Средняя масса взрослого человека 1,8 кг; однако небольшой половой диморфизм разделяет мужчин (2.38 кг) от самок (1,76 кг). (Anzelc, 2009; Fleagle and Meldrum, 1988; Norconk, 2006)

    • самец крупнее
    • полы окрашены или окрашены по-разному
    • самец более красочный
    • Средняя масса
      1.871 кг
      4,12 фунта

    Репродукция

    Саки, как известно, моногамны в неволе (в зоопарках), хотя Уотерс (1995) указывает, что в дикой природе были исключения. Анзельк (2009) предполагает, что моногамия в дикой природе встречается реже, чем ожидалось, и реже, когда группы насчитывают более 2–3 особей. Группы от 4 до 6 не редкость и могут включать более одного взрослого самца или самку.Это предполагает полигамную или полиандрическую систему спаривания, в зависимости от разбивки взрослых в группе. (Anzelc, 2009; Waters, 1995)

    Самцы и самки живут небольшими группами. Несмотря на практику моногамии в зоопарках, исследование диких саки в Венесуэле показало, что некоторые саки не были моногамными. В диких группах самцы будут звонить самкам во время брачного сезона, а не в качестве сигнала тревоги. Самцы достигают половой зрелости примерно через 32 месяца. Женщины примерно того же возраста, но может пройти на несколько месяцев больше.Только когда цикл яичников самок станет регулярным, они станут половозрелыми. Периоды беременности у саки в среднем 146 дней, самки приносят по одному потомству. Братья и сестры Саки из предыдущего года или двух могут помочь ухаживать за новорожденным саки. (Норконк, 2006)

    • Период размножения
      Сакис размножаются один раз в год.
    • Сезон размножения
      Сакисская порода весной.
    • Среднее количество потомков
      1
    • Средний срок беременности
      146 дней
    • Средний возраст половой или репродуктивной зрелости (мужчины)
      32 месяца

    Самки саки являются преобладающими опекунами.Младенцы остаются прикрепленными к бедру матери с рождения до 1 месяца. В возрасте от одного до четырех месяцев молодые переходят в спинное положение, в котором они могут достичь большей подвижности. Первые 3 месяца матери вынашивают младенцев. Когда ребенку исполнится около 5 месяцев, мать перестает носить его. Они кормят, защищают и лелеют детенышей, пока они не будут готовы к самостоятельности. Однако младенцы наблюдают за одним событием родов перед тем, как покинуть свою семейную группу. (Norconk, 2006; Waters, 1995)

    • женская родительская забота
    • до вылупления / рождения
    • перед отъемом / оперением
    • до обретения независимости
    • длительный период обучения несовершеннолетних

    Срок службы / Долговечность

    Известно, что в дикой природе белолицые саки живут около 15 лет.Один пойманный в неволе саки дожил до 36 лет, из них 28 лет он провел в неволе. (де Магальяэс и Коста, 2009 г.)

    • Срок службы
      Статус: плен
      36 (старшая)
    • Средняя продолжительность жизни
      Статус: дикий
      15 лет

    Поведение

    Саки социальны, но живут небольшими группами от 2 до 4 человек.Группы путешествуют вместе ежедневно и могут легко преодолевать от 1 до 2 км в день. Большинство движений происходит ранним утром и ранним днем. В пути они проводят около 9 часов. Эти приступы активности относительно короче, чем у родственных обезьян, которые могут быть активными от 10 до 12 часов в день. Саки — искусные прыгуны, помогающие избегать хищников. Самцы и самки саки проявляют ухаживающее и брачное поведение, наиболее часто встречающееся между матерями и младенцами. Саки мужского и женского пола учат друг друга воспитывать молодых.Известно, что в неволе саки несут младенца члена группы. (Anzelc, 2009; Walker, 2005; Waters, 1995)

    Самки в неволе начинают воспроизводить потомство намного раньше, чем в дикой природе, что приводит к более ранней смертности. По достижении минимум 37 месяцев выживаемость особи значительно увеличивается. Чем дольше самка ждет размножения, тем дольше она проживет. Один из примеров поздних родов наблюдался у 18-летнего саки, родившего в зоопарке.2

    Домашний диапазон

    Известно, что группы саки в Суринаме используют относительно небольшой участок земли в 10 гектаров. Переселенные группы используют гораздо более крупные участки земли, и по отчетам от 68 до 152 га были типичными. Эти саки будут отмечать и защищать свою территорию рядом действий. Anzelc (2009) резюмирует их как «трение обонятельными железами (грудные / гулярные / аногенитальные), промывание мочой и территориальные крики…. и агонистические взаимодействия с использованием ворчания, трелей, встряхивания ветвями и телом, пилоэрекции и быстрых преследований, чтобы угрожать и вытеснять членов вне группы »(Anzelc, 2009)

    Коммуникация и восприятие

    Саки живут небольшими группами от 2 до 4 особей; однако сообщалось о более крупных группах из 6 или более, которые могут включать более одного взрослого самца или самку для размножения. Для установления территории у них есть громкие голосовые призывы, которые обычно исполняются дуэтами моногамных мужчин и женщин.Эти дуэты укрепляют их ухаживания. Они также общаются, ухаживая друг за другом. Саки с белыми мордочками помечают область запахом. Самцы трутся грудью об деревья. Обычно они выбирают деревья со съедобными плодами, чтобы возбудить самок и попытаться стимулировать ухаживание во время сезона размножения. (Anzelc, 2009; Lehman, et al., 2001; Setz and Gaspar, 1997)

    Привычки к еде

    Саки поедают семена плодовых тел. Они тратят от 95 до 99% общего времени потребления на еду и взламывание семян.Круглый год они предпочитают есть семена от 38 до 88% времени. Листья также являются важным источником пищи. Они поедают молодые листья растений в засушливый сезон, когда плодов мало. При такой диете потребление жиров чрезвычайно велико, а белков — мало. Иногда они, как известно, поедают насекомых и цветы, когда мало фруктов. (Anzelc, 2009; Norconk and Conklin-Brittain, 2004)

    • листья
    • семена, зерна и орехи
    • фрукты
    • цветы

    Хищничество

    Когда наземный хищник, например, краснохвостый удав, приближается к саки, сначала подает сигнал тревоги.Затем они сгруппируются и нападут на хищника в надежде отогнать его. К другим наземным хищникам относятся ласки, называемые тайрами, ягуарами, зелеными анакондами и оцелотами. Их самая большая угроза — это птичьи хищники. Из-за своего размера саки — легкая добыча для орла-гарпии, который, как известно, нападает на крупных приматов. В одном исследовании сообщалось о большем количестве сигналов тревоги, когда есть птичья угроза, такая как орел или стервятник. Когда замечают хищную птицу, саки издают сигнал тревоги, который отражается эхом члена группы, и затем они остаются совершенно неподвижными.По прошествии времени саки могут выскользнуть незамеченными и направиться к самым нижним частям купола. Они стараются максимально скрыться в навесе. (Норконк и Глисон, 2002)

    Роли экосистемы

    У Саки есть паразиты, типичные для обезьян Нового Света и нечеловеческих приматов. Например, распространенными паразитами являются круглые черви (Pterygodermatites nycticebi). Сердечные черви (Dirofilaria immitis) также присутствуют у этого вида. Они также могут заразиться такими заболеваниями, как диабет и вирус Маяро (который содержится у млекопитающих, живущих на деревьях).(Гэмбл и др., 1998; Тойзи и др., 2003)

    Комменсальные / паразитические виды

    Экономическое значение для людей: положительный результат

    Белолицые саки — характерные организмы, вызывающие большой интерес в зоопарках, однако в последнее время их используют из-за их харизмы. Эти обезьяны продаются в качестве домашних животных, что наносит вред саки. Местные жители охотятся на них как на источник пропитания.Это вредит популяции саки, потому что они не размножаются достаточно быстро, чтобы заменить убитых и захваченных особей. («Сакская обезьяна с белым лицом», 2012)

    Экономическое значение для людей: отрицательный

    Сакис может переносить болезни, которые могут передаваться человеку, включая вирус гепатита и естественный герпес-вирс (ВПГ-1). Однако они не являются основным переносчиком болезни. (Шренцель и др., 2003)

    Статус сохранения

    Этот вид в настоящее время не внесен в список МСОП и не вызывает особого беспокойства у менеджеров по охране природы.Однако из-за разрушения среды обитания и торговли домашними животными этот статус может измениться. Он внесен в Приложение II СИТЕС, что указывает на то, что вид может оказаться под угрозой, если торговля или импорт и / или экспорт не будут регулироваться. (Вейга и Марш, 2008 г.)

    Авторы

    Николь Грубич (автор), Рэдфордский университет, Карен Пауэрс (редактор), Рэдфордский университет, Кирстен Ньютофф (редактор), Рэдфордский университет, Мелисса Уистлман (редактор), Рэдфордский университет.

    Глоссарий

    Неотропический

    проживает в южной части Нового Света. Другими словами, Центральная и Южная Америка.

    акустический

    использует звук для общения

    апосематик

    , имеющий окраску, которая выполняет защитную функцию для животного, обычно используется для обозначения животных с цветом, который предупреждает хищников об их токсичности.Например: животные с ярко-красной или желтой окраской часто токсичны или неприятны.

    древесный

    Обращение к животному, живущему на деревьях; лазание по деревьям.

    двусторонняя симметрия

    , имеющий такую ​​симметрию тела, что животное можно разделить в одной плоскости на две зеркальные половины.У животных с двусторонней симметрией есть спинная и вентральная стороны, а также передний и задний концы. Синапоморфия билатериев.

    вызывает или переносит болезнь домашних животных

    либо напрямую вызывает, либо косвенно передает заболевание домашнему животному

    химическая

    использует запахи или другие химические вещества для общения

    дуэтов

    для совместного отображения, обычно со звуками в очень скоординированной манере, в то же время, что и один другой особь того же вида, часто партнер

    эндотермический

    животных, которые используют выделяемое метаболическим путем тепло для регулирования температуры тела независимо от температуры окружающей среды.Эндотермия — это синапоморфия млекопитающих, хотя она могла возникнуть у (ныне вымершего) предка синапсидов; летопись окаменелостей не различает эти возможности. Сходится у птиц.

    женская родительская опека

    родительскую опеку осуществляют женщины

    лист

    животное, которое в основном ест листья.

    еда

    Вещество, обеспечивающее живое существо питательными веществами и энергией.

    плодоядные

    животное, которое в основном ест фрукты

    зерноядное животное

    животное, которое в основном ест семена

    травоядное животное

    Животное, питающееся в основном растениями или их частями.

    итеропарная

    потомков производятся более чем в одной группе (пометы, кладки и т. Д.) И в течение нескольких сезонов (или других периодов, благоприятных для воспроизводства). По определению, итеропородящие животные должны выживать в течение нескольких сезонов (или периодических изменений состояния).

    моногамный

    Имея по одному партнеру за раз.

    подвижный

    имеют возможность перемещаться с одного места на другое.

    родной диапазон

    район, в котором животное обитает в природе, регион, в котором оно является эндемиком.

    зоотовары

    — это бизнес по покупке и продаже животных, чтобы люди держали их дома в качестве домашних животных.

    феромоны

    химикатов, выбрасываемых в воздух или воду, которые обнаруживаются другими животными того же вида и реагируют на них

    полиандро

    Относится к системе спаривания, при которой самка спаривается с несколькими самцами в течение одного сезона размножения (сравните полигинность).

    полигинный

    , имеющие одновременно более одной самки

    тропический лес
    В

    тропических лесах, как умеренных, так и тропических, преобладают деревья, часто образующие закрытый навес с небольшим количеством света, достигающего земли.Обильны также эпифиты и вьющиеся растения. Количество осадков, как правило, не ограничено, но может быть сезонным.

    ароматических знаков

    общается, выделяя запахи из специальных желез и помещая их на поверхность, чтобы другие могли почувствовать их запах или вкус

    сезонное разведение

    разведение привязано к определенному сезону

    сидячий

    остается на том же участке

    половой

    воспроизводство, включающее сочетание генетического вклада двух особей, мужчины и женщины

    социальная

    ассоциируется с другими представителями своего вида; образует социальные группы.

    тактильный

    использует прикосновение для связи

    наземные

    Живут на земле.

    территориальный

    защищает территорию в пределах ареала обитания, занятую отдельными животными или группой животных одного вида и удерживаемую посредством открытой защиты, демонстрации или рекламы

    тропический

    регион Земли, окружающий экватор, с 23.От 5 градусов северной широты до 23,5 градусов южной широты.

    колебания

    движения твердой поверхности, производимые животными как сигналы другим

    визуальный

    использует зрение для связи

    живородящие

    размножение, при котором оплодотворение и развитие происходят в женском организме, а развивающийся эмбрион получает питание от самки.

    Список литературы

    2012. «Сакская белолицая обезьяна» (Он-лайн). Зоопарк Орегона. Доступ 09 апреля 2012 г. на http://www.oregonzoo.org/discover/animals/white-faced-saki-monkey.

    Анзельц, А. 2009. Модели поиска и передвижения белолицых саков в природном парке Браунсберг, Суринам: предварительные доказательства целенаправленного поведения при поиске пищи.Кент, Огайо: Государственный университет Кента, магистерская диссертация, 194 oo .. Доступ 24 апреля 2012 г. на http://www.personal.kent.edu/~mnorconk/pdfs/Anzelc-thesis-7-20-09b.pdf.

    Каннингем, Э., К. Янсон. 2007. Обобщение информации о местонахождении и ценности ресурсов белолицыми обезьянами саки (Pithecia pithecia). Познание животных, 10/3: 293-304.

    Fleagle, J., D. Meldrum. 1988. Двигательное поведение и морфология скелета двух симпатрических обезьян Pitheciine, Pithecia pithecia и Chiropotes satanas.Американский журнал приматологии, 16/3: 227-249.

    Гэмбл, К., Дж. Фрид, Г. Рубин. 1998. Предположительный дирофиляриоз у бледной обезьяны саки (Pithecia pithecia). Журнал медицины зоопарков и дикой природы, 29/1: 50-54.

    Lehman, S., W. Prince, M. Mayor. 2001. Различия в размере групп белолицых саки (Pithecia pithecia): свидетельства моногамии или сезонных собраний. Неотропические приматы, 9/3: 96-100.

    Ллойд, М., Дж. Суза, Дж. Пелто, А. Сэвидж. 1995. Сахарный диабет у белолицых саки (Pithecia pithecia). Журнал медицины зоопарков и дикой природы, 26/1: 76-81.

    Норконк, М. 2006. Долгосрочное исследование групповой динамики и женского воспроизводства у венесуэльских питесий питесий. Международный журнал приматологии, 27/3: 653-674.

    Норконк, М., А. Розенбергер, П. Гарбер. 1996. Адаптивные излучения неотропических приматов. Нью-Йорк: Пленум Пресс.

    Норконк, М., Н. Конклин-Бриттен. 2004. Разновидность плодородия: диета венесуэльского белолицого сакса. Международный журнал приматологии, 25/1: 1-26.

    Норконк, М., Т. Глисон. 2002. Риск хищничества и адаптации против хищников у белолицых саки, Pithecia pithecia. Стр. 169-183 в L Miller, ed. Ешьте или будьте съедены: поиск пищи среди приматов, чувствительный к хищникам Кембридж, Соединенное Королевство: Пресс-синдикат Кембриджского университета.

    Ричард-Хансен, К., К. Фурнье-Шамбрильон. 2001. Изобилие, использование пространства и модели активности белолицых саки (Pithecia pithecia) во Французской Гвиане. Американский журнал приматологии, 55/4: 203-221.

    Schrenzel, M., K. Osborn, A. Shima, R. Klieforth, G. Maalouf. 2003. Естественно возникающая смертельная инфекция вируса простого герпеса 1 в семье белолицых обезьян саки (Pithecia pithecia pithecia). Журнал медицинской приматологии, 32/1: 7-14.

    Э. Сетц, Дж. Энцвейлер, В. Сольферини, М. Амендола, Р. Бертон. 1999. Геофагия у златолицой обезьяны саки (Pithecia pithecia chrysocephala) в Центральной Амазонии. Журнал зоологии, 247/1: 91-103.

    Setz, E., D. Gaspar. 1997. Обоняние поведения у свободолюбивых златолицых обезьян саки, Pithecia pithecia chrysocephala: половые различия и контекст. Журнал зоологии, 241/3: 603-611.

    Сассман, Р., Дж. Филлипс-Конрой. 1995. Обзор распределения и плотности приматов Гайаны. Международный журнал приматологии, 16/5: 761-791.

    Туази, Б., Дж. Гардон, Р. Салас, Дж. Морван, М. Казанджи. 2003. Вирус Маяро у диких млекопитающих, Французская Гвиана. Новые инфекционные заболевания, 9/10: 1326-1329.

    Туази, Б., И. Фогель, Дж. Рейнс, Дж. Пуликен, Б. Карме, М. Казанджи, J. Vie. 2001. Оценка состояния здоровья перемещенных на свободную территорию приматов во Французской Гвиане.Американский журнал приматологии, 54/1: 1-16.

    Вейга, Л., Л. Марш. 2008. «Красный список видов, находящихся под угрозой исчезновения МСОП» (В сети). Pithecia pithecia. Доступ 23 февраля 2012 г. на www.iucnredlist.org.

    Уокер, С. 2005. Прыгающее поведение сатан Pithecia pithecia и Chiropotes в восточной части Венесуэлы. Американский журнал приматологии, 66/4: 369-387.

    Уоррен, К., М. Норконк. 1993г .: Физические и химические свойства фруктов и семян, употребляемых в пищу питециями и хиропотесами; в Суринаме и Венесуэле. Международный журнал приматологии, 14/2: 207-227.

    Waters, S. 1995. Обзор социальных параметров, которые влияют на разведение Pithecia pithecia в белолицых саки в неволе. Международный ежегодник зоопарков, 34/1: 147-153.

    de Magalhaes, J., J. Costa. 2009. База данных записей о долголетии позвоночных и их связи с другими особенностями жизненного цикла.Журнал эволюционной биологии, 22/8: 1770-1774.

    жителей сакской деревни — Патрату

    Саки — это небольшая деревня, расположенная в квартале Патрату района Рамгарх, Джаркханд, в котором проживает 235 семей. По данным переписи населения 2011 года, в селе Саки проживает 1258 человек, из которых 652 мужчины и 606 женщин.

    В селе Саки насчитывается 150 детей в возрасте от 0 до 6 лет, что составляет 11,92% от общей численности населения села. Среднее соотношение полов в деревне Саки составляет 929, что ниже, чем в среднем по штату Джаркханд (948).Соотношение полов среди детей у саков согласно переписи составляет 1174, что выше, чем в среднем в Джаркханде (948).

    В селе Саки более низкий уровень грамотности по сравнению с Джаркхандом. В 2011 году уровень грамотности в селе Саки составлял 64,08% по сравнению с 66,41% в Джаркханде. В Саках уровень грамотности мужчин составляет 73,93%, а уровень грамотности женщин — 53,14%.

    Согласно конституции Индии и Акту Панчяти Раадж, деревней Саки управляет Сарпанч (глава деревни), который избирается представителем деревни. На нашем сайте нет информации о школах и больницах в селе Саки.

    Saki Data

    Сведения Всего Мужской Женский
    Общее количество домов 235
    Население 1,258 652 606
    Детский (0-6) 150 69 81
    График Caste 0 0 0
    Расписание Tribe 1,248 646 602
    Грамотность 64.08% 73,93% 53,14%
    Всего рабочих 524 342 182
    Главный рабочий 514
    Маргинальный рабочий 10 2 8

    Кастовой фактор

    В селе Саки большая часть населения — выходцы из Schedule Tribe (ST).График Племя (СТ) составляет 99,21% от общей численности населения села Саки. В сакской деревне Рамгарх нет населения из касты расписания (SC).

    Рабочий профиль

    В селе Саки 524 человека были заняты трудовой деятельностью. 98,09% работников описывают свою работу как основную работу (занятость или получение более шести месяцев), в то время как 1,91% были вовлечены в маржинальную деятельность, обеспечивающую средства к существованию менее 6 месяцев. Из 524 рабочих, занятых на основных работах, 107 были земледельцами (собственниками или совладельцами), а 382 — сельскохозяйственными рабочими.

    Серологическая распространенность антител SARS-CoV-2 среди населения в целом и профессиональных групп высокого риска в 18 городах Ирана: популяционное кросс-секционное исследование

    Резюме

    Общие сведения

    Наблюдалось быстрое увеличение случаев COVID-19 во многих городах Ирана к началу пандемии. Однако истинная частота заражения остается неизвестной. Мы стремились оценить распространенность антител к коронавирусу 2 тяжелого острого респираторного синдрома (SARS-CoV-2) в 18 городах Ирана в качестве индикатора уровня инфицирования.

    Методы

    В этом популяционном перекрестном исследовании мы случайным образом выбрали и пригласили участников исследования из общей популяции (из списков людей, зарегистрированных в иранской системе электронных медицинских карт или медицинских центрах) и из группы высокого риска. популяция лиц, которые могут иметь тесный социальный контакт с людьми, инфицированными SARS-CoV-2, по своей профессии (из списков сотрудников, предоставленных соответствующими агентствами или компаниями, такими как сети супермаркетов) в 18 городах в 17 провинциях Ирана.Участникам задавали вопросы об их демографических характеристиках, истории болезни, недавних симптомах, связанных с COVID-19, и воздействиях, связанных с COVID-19. Утвержденные Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов Ирана наборы ELISA Pishtaz Teb SARS-CoV-2 были использованы для обнаружения антител IgG и IgM, специфичных к SARS-CoV-2, в образцах крови участников. Распространенность серотипа оценивалась на основе результатов теста ELISA с поправкой на вес населения (по возрасту, полу и размеру населения города) и эффективность теста (в соответствии с нашей независимой проверкой чувствительности и специфичности).

    Результаты

    Из 9181 человека, с которым первоначально связались в период с 17 апреля по 2 июня 2020 года, 243 человека отказались сдать образцы крови, а 36 не предоставили демографическую информацию и были исключены из анализа. Из 8902 человек, включенных в анализ, 5372 имели профессии с высоким риском заражения SARS-CoV-2, а 3530 были набраны из общей популяции. Распространенность серопозитивности на антитела в общей популяции с поправкой на вес и результаты теста составила 17,1% (95% ДИ 14,6–19,5), что означает, что 4 265 542 (95% ДИ 3 659 043– По состоянию на конец апреля 2020 г. были инфицированы 4887078) человек из 18 городов, включенных в список.Скорректированная распространенность антител, специфичных к SARS-CoV-2, сильно варьировалась в зависимости от города, при этом самые высокие оценки были обнаружены в Раште (72,6% [53,9–92,8]) и Куме (58,5% [37,22]. –83,9]). Общая популяция с поправкой на массу тела и с поправкой на результаты тестов в популяции высокого риска составила 20,0% (18,5–21,7) и не сильно различалась между включенными профессиями.

    Интерпретации

    Серопревалентность, вероятно, будет намного выше, чем заявленная распространенность COVID-19 на основе подтвержденных случаев COVID-19 в Иране.Несмотря на высокую распространенность серотипа в нескольких городах, большая часть населения все еще не инфицирована. Поэтому необходимо определить потенциальные недостатки текущей политики общественного здравоохранения, чтобы предотвратить будущие волны эпидемии в Иране.

    Финансирование

    Министерство здравоохранения и медицинского образования Ирана.

    Перевод

    Перевод аннотации на фарси см. В разделе «Дополнительные материалы».

    Рекомендуемые статьиЦитирующие статьи (0)

    Просмотреть аннотацию

    © 2020 Elsevier Ltd.Все права защищены.

    Рекомендуемые статьи

    Ссылки на статьи

    Связь между полиморфизмом ICOS и иммунной тромбоцитопенией в иранской популяции Purrahman D, Jaseb K, Kaydani GA, Saki N

    7


    ОРИГИНАЛЬНАЯ СТАТЬЯ
    Год : 2020 | Том : 9 | Выпуск : 5 | Страница : 186-192

    Связь между полиморфизмами ICOS и иммунной тромбоцитопенией в иранской популяции

    Дарьюш Пуррахман 1 , Кавех Джасеб 2 , Голам Аббас Кайдани 3 , Najmaldin 1 Saki
    4 Институт медицинских исследований, Университет медицинских наук Ахваза Джундишапура; Отделение лабораторных наук, Школа смежных медицинских наук, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран
    2 Исследовательский центр талассемии и гемоглобинопатии, Институт медицинских исследований, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран
    3 Департамент доктор лабораторных наук, Школа смежных медицинских наук, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

    Дата подачи 03 марта 2020 г.
    Дата принятия решения 13 июня 2020 г.
    Дата принятия 15 июля 2020 г.
    Дата публикации в Интернете 12 октября 2020 г.

    Адрес для корреспонденции :
    Najmaldin Saki
    Научно-исследовательский центр талассемии и гемоглобинопатии, Институт медицинских исследований, Университет медицинских наук Ахваз Джундишапур, Ахваз
    Иран

    Источник поддержки: Нет, 900 4528 900 Конфликт интересов

    Чек

    DOI: 10.4103 / ccij.ccij_35_20


    Контекст: Иммунная тромбоцитопения (ИТП) — это аутоиммунное заболевание, вызванное нарушением регуляции иммунной системы, при котором циркулирующие тромбоциты (Plt) разрушаются ретикулоэндотелиальной системой, что приводит к геморрагическим проявлениям у пациентов. Цели: Недавние исследования показали, что полиморфизмы могут вносить вклад в предрасположенность и исход ИТП. Учитывая важность фолликулярных Т-клеток-помощников (Tfh) в ИТП, мы оценили полиморфизм индуцибельного Т-клеточного костимулятора (ICOS) как поверхностного маркера Tfh среди пациентов с ИТП, чтобы найти вероятный прогностический фактор. Субъекты и методы: Мы набрали 54 пациента ИТП и 46 человек без тромбоцитопении в анамнезе для проведения этого исследования «случай – контроль». В дополнение к стандартным лабораторным параметрам с помощью полимеразной цепной реакции оценивали три полиморфизма, а именно rs106, rs4404254 и rs107 гена ICOS. Статистический анализ: тестов Манна – Уитни, Краскела – Уоллиса и хи-квадрат были использованы для сравнения и оценки данных, и P <0,05 указали на статистически значимую связь. Результаты: Результаты нашего исследования показали, что частоты аллелей и генотипов всех трех рассматриваемых полиморфизмов были одинаковыми для случая и контроля без существенной разницы. Однако наша оценка показала более высокое среднее количество Plt в генотипе RS4404254 CC, чем в других исследуемых генотипах. Выводы: Похоже, что полиморфизмы rs107, rs4404254 и rs106 гена ICOS не влияют на восприимчивость к ИТП. Тем не менее, мы обнаружили, что пациенты с полиморфизмом RS4404254CC имеют лучший прогноз из-за более высокого количества Plt как у пациентов с острой, так и с хронической ИТП.

    Ключевые слова: Аутоиммунная, иммунная тромбоцитопения, индуцибельный костимулятор, нарушение тромбоцитов, полиморфизм


    Как цитировать эту статью:
    Purrahman D, Jaseb KOS, Kaydani Association полиморфизмы и иммунная тромбоцитопения в иранской популяции. Clin Cancer Investigate J 2020; 9: 186-92

    Как цитировать этот URL:
    Purrahman D, Jaseb K, Kaydani GA, Saki N.Связь между полиморфизмом ICOS и иммунной тромбоцитопенией в иранской популяции. Clin Cancer Investigation J [серия онлайн] 2020 [цитировано 14 апреля 2021 года]; 9: 186-92. Доступно по адресу: https://www.ccij-online.org/text.asp?2020/9/5/186/297996
    Введение

    Иммунная тромбоцитопения (ИТП) аутоиммунное заболевание, которое возникает в результате дефекта периферической толерантности, при котором количество циркулирующих тромбоцитов (Plt) достигает <100 × 10 9 / л. [1], [2] Заболеваемость ИТП колеблется от 4 до 10 на 100 000 человек, и наиболее частым ее проявлением являются кровотечения из кожи и слизистых оболочек. [2], [3], [4], [5], [6] Наиболее известная классификация ИТП относится к острым и хроническим заболеваниям, которая основана на оценке течения болезни, а также возраста пациента и включает имеет решающее значение для терапевтических подходов. [4], [7] ИТП также может быть вторичным по отношению к другим состояниям, таким как инфекция (вирус иммунодефицита человека, вирус гепатита С и Helicobacter pylori ) или первичный иммунный дефицит (аутоиммунный лимфопролиферативный синдром и общий вариабельный иммунодефицит. ).Однако 80% случаев ИТП являются первичными, которые труднее лечить, чем вторичные ИТП. [3], [4], [6]

    До сих пор зарубежные исследования пациентов с ИТП из Ирана не касались распространенности ИТП в этой стране; однако мы изучили персидские исследования, в которых говорится, что распространенность ИТП в Иране аналогична международным исследованиям. Кроме того, кортикостероиды и внутривенный иммуноглобулин обычно используются для пациентов с острой формой заболевания, а иммунодепрессанты, такие как ритуксимаб, — для пациентов с хроническими заболеваниями. [8]

    Предыдущие исследования показали, что клеточная иммунная дисфункция, которая возникает из-за дисбаланса и нарушения Т-клеток, играет центральную роль в управлении ИТП. [1], [6], [9] Рецепторы семейства CD28 участвуют в костимулирующей передаче сигналов Т-клеток, что важно для активации и пролиферации Т-клеток. [10] Видным представителем этого семейства является CD28, подавление которого, как было показано, вызывает дисфункцию Т-клеток. [10] Исследования также показали, что блокирование взаимодействия членов семейства CD28 приводит к гликопротеин-специфической толерантности Т-клеток. [6], [9]

    Индуцибельный костимулятор Т-клеток (ICOS) или CD278 (2q33) является членом семейства CD28, который широко связан со структурой и функцией CD28. [11] Различные подмножества Т-клеток экспрессируют ICOS, включая фолликулярный помощник Т (Tfh) с фенотипическим признаком CD3 + CD5 + CXCR5 + ICOS + PD-1 + . [7], [12] Высвобождая интерлейкин (IL) -21, Tfh играет потенциальную роль в продукции аутоантител против обычных поверхностных гликопротеинов Plt (например,г., ГП IIb / IIIa). [3], [13], [14] ICOS клеточной поверхности T FH взаимодействует со своим лигандом (CD275 или ICOS-L) на поверхности B-клеток, продлевая межклеточный контакт за счет созревания Ab-аффинности, B -клеточная выживаемость и дифференцировка плазматических клеток (ПК). [11], [15], [16] Исследование Се и др. . показали, что Tfh от пациентов с ИТП имеет тип по ICOS high. Более того, количество клеток ICOS high Tfh у пациентов с ИТП больше, чем у здоровых контролей (HC).Кроме того, их исследование выявило положительную корреляцию между высоким уровнем ICOS и / или высоким уровнем PD-1 с уровнями IL-21 в сыворотке крови пациентов. [12] Аналогичные оценки на людях и мышах показали, что отсутствие ICOS было связано с серьезным снижением CXCR5 + CD4 + Tfh-клеток в зародышевых центрах и периферической крови. [17] С другой стороны, исследования, проведенные по другим аутоиммунным заболеваниям (AID), таким как системная красная волчанка (SLE), аутоиммунное заболевание щитовидной железы, ревматоидный артрит (RA) и синдром Шегрена, показали, что высокая экспрессия ICOS наряду с CXCR5 + и CD4 + в качестве маркеров циркулирующих клеток Tfh тесно связаны с продукцией аутоантител в этих AID. [12]

    Для ИТП не разработан золотой стандарт; поэтому в нескольких исследованиях оценивались различные факторы (в том числе различия в конкретном генетическом фоне) и их связь с ИТП. [1], [4] Учитывая важность передачи сигналов ICOS в патогенезе ИТП [9] и оценку уровней экспрессии ICOS в клетках Tfh пациентов с ИТП, полиморфизмы гена ICOS могут влиять на патогенез ИТП, изменяя экспрессию ICOS. Тем не менее, насколько нам известно, до настоящего времени не было проведено исследований корреляции между полиморфизмом гена ICOS и ITP.В этом исследовании мы стремились достичь нового диагностического и прогностического фактора при ИТП путем оценки трех полиморфизмов гена ICOS в когорте из 100 субъектов.

    Субъекты и методы

    Характеристики исследуемой выборки

    Для проведения этого исследования случай – контроль мы включили 54 пациента с ИТП (24 мужчины и 30 женщин), которые обратились в больницу Бакаи. Ахваза в 2019 году. Критериями включения были физикальное обследование, анамнез и лабораторные результаты, такие как количество Plt <100 × 10 9 / л плюс нормальный уровень гемоглобина и лейкоцитов (WBC), а также отсутствие сопутствующего заболевания с тромбоцитопенией. такие как СКВ, текущий диагноз злокачественных новообразований и вирусных заболеваний. [15], [18] Кроме того, с учетом различий в лабораторных параметрах, а также в лечении пациентов с острой и хронической ИТП, мы разделили наших субъектов на острые и хронические группы в зависимости от продолжительности заболевания и возраста [Рисунок 1]. Кроме того, 46 субъектов без ИТП или других аутоиммунных заболеваний, подходящих по возрасту и полу, были набраны в группу HC. Демографические характеристики исследуемой популяции суммированы в [Табл. 1]. Следует отметить, что этический комитет заместителя по исследованиям AJUMS одобрил это исследование с IR.Кодекс этики AJUMS.REC.1397.676.

    Рис. 1: Блок-схема, показывающая выбор и исключение пациентов, полимеразную цепную реакцию и лабораторное обследование. ИТП указывает на иммунную тромбоцитопению

    Для просмотра нажмите здесь

    Выделение ДНК и генотипирование

    У субъектов было взято 2 мл крови с антикоагулянтом ЭДТА (SL / Италия), и ДНК была извлечена с использованием коммерческого набора согласно инструкции производителя (Roche / Германия).Соответствие экстрагированной ДНК было подтверждено спектрофотометром Thermo Scientific NanoDrop Spectrophotometer (Onec), и образцы хранили при -70 ° C для последующих этапов. Из-за ограниченного количества исследований полиморфизмов ICOS в AID был рассмотрен полиморфизм, расположенный в регуляторной области гена ICOS, а также доступные публикации по этим полиморфизмам. [16], [19] Таким образом, для оценки в ITP были выбраны три полиморфизма rs106, rs107 (c. 1624C> T) и rs4404254 из гена ICOS.

    В плане исследования пара праймеров была разработана для полимеразной цепной реакции (ПЦР) из-за близости полиморфизмов друг к другу. Последовательность праймера следующая: прямая: TTCTTTCCTCTGCTGCTCAA и обратная: GGAGTCTCTCAACCCTGGAA. В наших ПЦР-реакциях задействовано 25 λ реакционной смеси. Каждая пробирка содержала 0,25 λ каждого праймера (разведение 1: 2), 12,5 λ дистиллированной воды, 10 λ коммерческого мастер-микса (Amplicon / Дания) и, наконец, 2 λ образца. Для приготовления продукта ПЦР использовали 2х термоциклер (Peqlab Biotechnologie Gmbh) с циклом нагрева крышки до 110.Использовали 0 ° C, 94,0 ° C в течение 5 минут, 72 ° C в течение минуты, 60,0 ° C в течение 1,0 минуты и 94,0 ° C в течение 1,0 минуты. Использовали 30x пусковой цикл (1,0). Чтобы контролировать работу, образцы были загружены в 2% агарозный гель, который сформировал полосу в 500 п.н. [Рисунок 2], и во время этих этапов не было пропущено ни одного образца. Наконец, был использован анализатор ДНК ABI PRISM 3130 × 1 с использованием секвенирования SANGER [Рисунок 3].

    Рисунок 2: Запуск образцов полиморфизма ICOS в агарозном геле вместе с Leder 50. Все образцы образовывали полосы в области 500 п.н.

    Щелкните здесь, чтобы просмотреть

    Рисунок 3: Последовательность полиморфизмов Rs4404254T> C.(ac) Гомозиготные основные, гетерозиготные и гомозиготные минорные аллели в полиморфизме Rs4404254T> C соответственно

    Щелкните здесь, чтобы просмотреть

    Статистический анализ

    Среднее и стандартное отклонение использовались для численных данных, а также для численных данных. и процент для качественных данных. Частоты аллелей и генотипов получали прямым подсчетом. Сравнивая полученную частоту с ожидаемой, равновесие Харди – Вайнберга (HWE) было оценено с помощью хи-квадрат, а также оценены отношение шансов и доверительный интервал.Логистическая регрессия использовалась для анализа значений лабораторных показателей в исследуемой популяции. Тесты Манна-Уитни, Краскела-Уоллиса и хи-квадрат были использованы для исследования значимости связи полиморфизма с предрасположенностью к ИТП. Все анализы были выполнены с использованием SPSS (IBM Corporation, Армонк, Нью-Йорк, США) версии 25.0, и P 0,05 считалось уровнем значимости.

    Результаты

    Сравнение демографических характеристик между пациентами и здоровыми людьми

    Это исследование проводилось на 54 пациентах, характеристики которых суммированы в [Таблица 1].Было 40 пациентов с острой ИТП (19 мужчин и 21 женщина), а остальные (14 пациентов) находились в хронической фазе (5 мужчин и 9 женщин). Средний возраст пациентов в хронической и острой группах составил 36,00 ± 13,00 и 12,16 ± 6,66 года соответственно. Среднее количество Plt в острой и хронической группах составляло 31,50 × 10 9 / л и 29,85 × 10 9 / л соответственно, а средняя разница в количестве Plt в группах случая и контрольной группе (265,50 × 10 9 / л L) был потенциально значимым ( P P <0.002 и <0,001 соответственно).

    Частоты аллелей и распределение генотипов

    Сравнивая распределение генотипов, полученное в этом исследовании, и ожидаемую частоту в отношении аналогичных исследований, было обнаружено, что частоты нашего исследования согласуются с HWE. [11], [19], [20] Частота полиморфизмов и аллелей гена ICOS представлена ​​в [Табл. 2]. Исследование полиморфизма rs107C> T показало, что паттерн экспрессии генотипа в острой и хронической группах был подобен группе HC и не был статистически значимым ( P = 0.955). Более того, ни один субъект в обеих популяциях не был гомозиготным носителем минорных аллелей RS107C> T. Аллели полиморфизма rs107C> T также имели сходное распределение в группах наблюдения и контроля без значимой разницы ( P = 0,955).

    Оценка rs4404254T> C показала наличие всех трех генотипов этого полиморфизма в экспериментальной и контрольной группах. Картина распределения генотипов показала различие между хронической и острой группами, которое не было статистически значимым ( P = 0.609). Также не было существенной разницы в частоте случаев и генотипов HC ( P = 0,882). Кроме того, частота аллелей Т и С полиморфизма Rs4404254 была сходной в исследуемых группах без достоверной разницы ( P = 0,652).

    Исследование полиморфизма rs106A> T выявило отсутствие носителей генотипа ТТ (минорный гомозиготный аллель) в исследуемой популяции. Частота генотипов AA и AT была сходной в группе «случай – контроль», а также в группах острого и хронического заболевания и не была статистически значимой ( P = 0.726 и 0,948 соответственно). Более того, частота аллелей А и Т не показала какой-либо значимой разницы между группами ( P = 0,726).

    Связь между полиморфизмами и лабораторными показателями при постановке диагноза

    Согласно [Таблице 3], мы исследовали связь стандартных лабораторных показателей с генотипом каждого полиморфизма в наших группах исследования. Не было обнаружено значительных различий по большинству показателей, таких как эритроциты, гематокрит, MPV и PDW; однако результаты подсчета Plt показали, что носители генотипа rs4404254CC имели более высокие средние значения, чем два других генотипа этого полиморфизма, что было статистически значимым ( P = 0.028). Более высокие количества Plt наблюдались в rs106AT и rs107CT, а также в rs4404254CC; тем не менее, их статистический анализ не показал значимой разницы ( P = 0,083 и 0,054, соответственно). MPV и PDW также отдельно рассматривались в острой и хронической группах как два важных параметра ИТП [Таблица 4]. Хотя ни одна из корреляций не была значимой, Rs4404254CC и RS106AT в острой группе, соответственно, показали наивысшее среднее значение PDW и наименьшее среднее значение MPV.

    Таблица 3: Связь между лабораторными параметрами и генотипом каждого полиморфизма в группе пациентов

    Щелкните здесь, чтобы просмотреть

    Таблица 4: Связь полиморфизма индуцибельного костимулятора со средним объемом тромбоцитов и ширина распределения тромбоцитов среди пациентов

    Нажмите здесь для просмотра

    Ассоциация полиморфизмов с количеством тромбоцитов до и после лечения

    После того, как пациенты достигли ремиссии, связь каждого полиморфизма с количеством Plt при диагностике и ремиссии была исследовали отдельно как в острой, так и в хронической группе [Таблица 5].Оценка средних значений показала более высокое количество Plt до и после лечения у острых пациентов с генотипом RS107CT; однако разница не была статистически значимой ( P = 0,089 и 0,092 соответственно). Разница в количестве Plt до и после терапии не была значимой для других исследуемых генотипов ни в острой, ни в хронической группах.

    Таблица 5: Связь полиморфизмов индуцибельных генов костимулятора с количеством тромбоцитов до и после лечения

    Щелкните здесь, чтобы просмотреть

    Обсуждение

    ITP является аутоиммунным заболеванием в котором главную роль играет дисфункция Т-клеток (особенно Tfh). [12] ICOS или CD278 является поверхностным маркером Tfh, который играет важную роль в патогенезе аутоиммунных заболеваний, таких как ИТП, из-за его участия в процессе дифференцировки ПК и переключении изотипа. [20], [21] Исследования показали связь полиморфизма ICOS с предрасположенностью к аутоиммунным заболеваниям, таким как диабет I типа, РА и системный склероз. [22], [23], [24] Тем не менее, насколько нам известно, взаимосвязь между полиморфизмом гена ICOS с ITP и родственными индексами до сих пор не исследована.Мы оценили три полиморфизма ICOS в когорте иранского населения из 100 человек, предполагая, что полиморфизмы гена ICOS могут влиять на ИТП через изменение уровня белка. Полиморфизмы, выбранные в нашем исследовании, расположены в 3′-нетранслируемой области (3′-UTR). 3′-UTR может влиять на стабильность, деградацию и посттранскрипционную регуляцию мРНК из-за своей важности в связывании регуляторного элемента. [25], [26]

    Одним из исследованных полиморфизмов является Rs107C> T, который, как было ранее показано в двух независимых исследованиях, коррелирует с уровнем мРНК ICOS из-за его расположения в сайте связывания miR, регулирующем уровень экспрессии ICOS. .Напротив, наше исследование не показало значительной разницы между частотой генотипа с аллелями RS107C> T у пациентов с ИТП и контрольной группы. В этом случае отвергается предположение об участии полиморфизма rs107C> T в ИТП. Более того, результаты RS106A> T не показывают никакой связи с ITP; однако предыдущее исследование подтвердило корреляцию этого полиморфизма с RA. [22]

    Полиморфизм RS4404254T> C также является некодирующим однонуклеотидным полиморфизмом, который не влияет на аминокислотную последовательность. [27] Наши результаты показали, что частота распределения генотипов и аллелей Rs4404254 была сходной в группах случаев и контрольной группе, что отвергает предположение об участии RS4404254T> C в ИТП. Тем не менее, пациенты, несущие генотип CC в нашем исследовании, показали более высокое среднее количество Plt (как острых, так и хронических) на момент постановки диагноза. Следовательно, носители этого генотипа, по-видимому, связаны с лучшим прогнозом по сравнению с двумя другими генотипами, что трудно оправдать и может быть связано с более низким количеством лейкоцитов у носителей этого генотипа CC [Таблица 3].Учитывая роль ICOS в активации и пролиферации Т-клеток, [18] , мы предполагаем, что генотип CC снижает количество и функцию Tfh-клеток за счет снижения функции ICOS, что, в свою очередь, снижает деградацию Plt. В соответствии с нашими результатами, Haimila et al . предположили, что присутствие минорного аллеля T в полиморфизме RS4404254T> C связано с отсутствием или задержкой функции трансплантата, что указывает на более высокий уровень иммунитета в присутствии аллеля T. [27] Исследование иммунного заболевания, называемого IgA-нефропатией, выявило значительную связь с носителями аллеля T (TT и CT). [28] Тем не менее, исследование полиморфизма RS4404254T> C при несегментарном витилиго и иммунном заболевании RA не выявило связи между этим полиморфизмом с этими заболеваниями или их ассоциированными индексами. [11], [21] Несогласованность результатов может быть объяснена влиянием таких параметров, как другие полиморфизмы, и сложной этиологией аутоиммунных заболеваний. Мы также наблюдали более высокое среднее количество Plt в rs107 CT, которое не было значимым [Таблица 3]. При сравнении носителей генотипов CC и CT кажется, что снижение функции ICOS и ослабление Tfh связаны с аллелем T.Однако, в отличие от нашей гипотезы, Haimila et al . показали, что наличие аллеля Т (СТ и ТТ) у реципиентов почечного трансплантата связано с более низкой выживаемостью пересаженной ткани. [27] Wu et al . показали, что генотип TT связан с более низкой общей выживаемостью у пациентов, перенесших трансплантацию гемопоэтических стволовых клеток. [29] Действительно, оба этих исследования указывают на более выраженную иммунную реакцию у носителей минорного аллеля Т (RS107).С другой стороны, не было обнаружено ассоциации между полиморфизмом rs107 и дефицитом IgA. [30] Оценка других индексов ITP, таких как MPV и PDW, не показала никакой связи с генотипами этого исследования [Таблица 4]. Однако в нашем исследовании был ряд ограничений. Во-первых, из-за распространенности ИТП и короткого периода исследования размер выборки был небольшим, особенно в подгруппе хронических больных. Во-вторых, из-за отсутствия генотипов rs106 TT и rs107 TT в нашей исследуемой популяции было невозможно оценить их влияние на ИТП.В-третьих, несколько исследований касались полиморфизмов, которые нас интересовали. Следовательно, для того, чтобы сделать выводы, необходимы дальнейшие исследования с большим размером выборки.

    Заключение

    Хотя наше исследование полиморфизмов rs107, rs4404254 и rs106 гена ICOS не имело значительной корреляции с вероятностью ИТП среди иранской популяции, мы действительно отмечаем, что люди, несущие гетерозиготные rs4404254 полиморфизм имеет более высокое количество Plt при постановке диагноза как в хронической, так и в острой группе, что предполагает лучший прогноз в них.

    Выражение признательности

    Эта работа финансировалась грантом TH97 / 15 от вице-канцлера по исследованиям Университета медицинских наук Ахваза Джундишапура. Эта статья основана на диссертации Дарьюша Пуррахмана.

    Финансовая поддержка и спонсорство

    Нет.

    Конфликт интересов

    Конфликта интересов нет.

    Ссылки

    1. LeVine DN, Брукс МБ. Иммунная тромбоцитопения (ИТП): обновление патофизиологии и диагностические дилеммы. Vet Clin Pathol 2019; 48 Приложение 1: 17-28.
    2. Goette NP, Glembotsky AC, Lev PR, Grodzielski M, Contrufo G, Pierdominici MS, et al . Апоптоз тромбоцитов при иммунной тромбоцитопении у взрослых: понимание механизма повреждения, вызванного аутоантителами. PLoS One 2016; 11: e0160563.
    3. Ли Дж., Салливан Дж. А., Ни Х.Патофизиология иммунной тромбоцитопении. Курр Опин Гематол 2018; 25: 373-81.
    4. Audia S, Mahévas M, Samson M, Godeau B, Bonnotte B. Патогенез иммунной тромбоцитопении. Autoimmun Rev 2017; 16: 620-32.
    5. Мулис Г., Одемар-Верже А., Арно Л., Люксембург С., Монтаструк Ф, Гаман А.М., и др. . Риск тромбоза у пациентов с первичной иммунной тромбоцитопенией и антифосфолипидными антителами: систематический обзор и метаанализ.Autoimmun Rev 2016; 15: 203-9.
    6. Лю X, Хоу Y, Пэн Дж. Достижения в иммунопатогенезе иммунной тромбоцитопении у взрослых. Фронт Мед 2013; 7: 418-24.
    7. Furudoï A, Rivière E, Lazaro E, Furudoï E, Viallard JF, Parrens M. Первичная иммунная тромбоцитопения у взрослых: данные гистологии селезенки и результаты в соответствии с использованием ритуксимаба на основе анализа 41 случая. Am J Surg Pathol 2018; 42: 401-12.
    8. Хемати З., Киани Д. Взаимосвязь между самооценкой и качеством жизни пациентов с идиопатической тромбоцитопенической пурпурой в больнице Сайед Аль-Шохада в Исфахане, Иран, в 2013 г. Int J Hematol Oncol Stem Cell Res 2016; 10: 79- 84.
    9. Ji X, Zhang L, Peng J, Hou M. Т-клеточные иммунные нарушения при иммунной тромбоцитопении. Журнал Hematol Oncol 2014; 7: 72.
    10. Li H, Hao Y, Zhang D, Liu W, Li Y, Lyu M, et al .Численные и функциональные дефекты в CD8 + CD28 — Т-супрессорных лимфоцитах у пациентов с первичной иммунной тромбоцитопенией. Br J Haematol 2017; 178: 292-301.
    11. Shin MK, Im SH, Park HJ, Kim SK, Yim SV, Chung JH, et al . Исследование ассоциации между полиморфизмами CD28, CTLA4 и ICOS и несегментарным витилиго в корейской популяции. Exp Ther Med 2011; 2: 1145-9.
    12. Xie J, Cui D, Liu Y, Jin J, Tong H, Wang L, и др. .Изменения фолликулярных Т-хелперов у пациентов с идиопатической тромбоцитопенической пурпурой. Int J Biol Sci 2015; 11: 220-9.
    13. Cines DB, Bussel JB, Liebman HA, Luning Prak ET. Синдром ИТП: патогенетическое и клиническое разнообразие. Кровь 2009; 113: 6511-21.
    14. Abadi U, Yarchovsky-Dolberg O, Ellis MH. Иммунная тромбоцитопения: последние достижения в патофизиологии и лечении. Clin Appl Thromb Hemost 2015; 21: 397-404.
    15. Chen Z, Zhou Z, Chen X, Xu J, Liu A, Du W, и др. . Однонуклеотидный полиморфизм в промоторе DNMT3B и риск идиопатической тромбоцитопенической пурпуры в китайской популяции. Дж. Клин Иммунол 2008; 28: 399-404.
    16. Ян Дж., Лю Дж., Чен Й, Тан В., Бо К., Сунь Й, и др. . Исследование полиморфизмов ICOS, CD28 и CD80 с риском гепатоцеллюлярной карциномы: исследование случай-контроль в популяции восточного Китая.Biosci Rep 2019; 39.
    17. Van DV, Bauer L, Kroczek RA, Hutloff A. Костимуляция ICOS по-разному влияет на Т-клетки вторичных лимфоидных органов и воспаленных тканей. Am J Respir Cell Mol Biol 2018; 59: 437-47.
    18. Эйада Т.К., Фаравела Х.М., Хоршид М.М., Шахин И.А., Селим Н.М., Халифа И.А. Генетические полиморфизмы FcγRIIa и FcγRIIIa в группе детской иммунной тромбоцитопенической пурпуры в Египте. Фибринолиз свертывания крови 2012; 23: 64-8.
    19. Bouwhuis MG, Gast A, Figl A, Eggermont AM, Hemminki K, Schadendorf D, et al . Полиморфизмы генов CD28 / CTLA4 / ICOS: роль в предрасположенности к злокачественной меланоме и прогнозе? Cancer Immunol Immunother 2010; 59: 303-12.
    20. Frydecka I, Karabon L, Jedynak A, Tomkiewicz A, Pawlak E, Wolowiec D, et al . Полиморфизмы гена ICOS при В-клеточном хроническом лимфоцитарном лейкозе в польской популяции.Американское общество гематологии; 2010.
    21. Kim YO, Kim HJ, Kim SK, Chung JH, Hong SJ. Связь полиморфизмов CD28 / CTLA4 / ICOS с предрасположенностью к ревматоидному артриту. Clin Chem Lab Med 2010; 48: 345-53.
    22. Уокер Э.Дж., Хиршфилд Г.М., Сюй Ц., Лу И, Лю Х, Лу И, и др. . Варианты и гаплотипы гена CTLA4 / ICOS связаны с ревматоидным артритом и первичным билиарным циррозом у населения Канады.Arthritis Rheum 2009; 60: 931-7.
    23. D’Amico F, Fiorito G, Skarmoutsou E, Granata M, Rossi GA, Trovato C, et al . Полиморфизм генов FOXP3, ICOS и ICOSL при системном склерозе: FOXP3 rs2294020 связан с прогрессированием заболевания у женщин в итальянской популяции. Иммунобиология 2018; 223: 112-7.
    24. Хигучи Т., Ока С., Фурукава Х., Накамура М., Комори А., Абиру С., и др. . Ассоциация однонуклеотидного полиморфизма перед ICOS с японским аутоиммунным гепатитом 1 типа.J Hum Genet 2017; 62: 481-4.
    25. Kaartinen T, Lappalainen J, Haimila K, Autero M, Partanen J. Генетические вариации в ICOS регулируют уровни мРНК ICOS и изоформ сплайсинга CTLA4. Мол Иммунол 2007; 44: 1644-51.
    26. Мао Й, Ван Ч, Мэн Ф, Конг Дж., Цао С., Цзян И, и др. . Полиморфизмы пути ICOS / CD28-ICOSL связаны с химиотерапевтическим ответом на основе капецитабина у пациентов с распространенным раком толстой кишки.

    Ваш комментарий будет первым

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    © 2019 Гранд Атлантис - перевозки груза по Дальнему Востоку.